ID: 990023507

View in Genome Browser
Species Human (GRCh38)
Location 5:51158150-51158172
Sequence TGAGCTCTTCTTTCAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990023503_990023507 11 Left 990023503 5:51158116-51158138 CCAACTAAAATGGAGTAAGAGAA No data
Right 990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990023507 Original CRISPR TGAGCTCTTCTTTCAACAGG AGG Intergenic
No off target data available for this crispr