ID: 990024378

View in Genome Browser
Species Human (GRCh38)
Location 5:51167505-51167527
Sequence TCTAGGTACCCTCATAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990024375_990024378 13 Left 990024375 5:51167469-51167491 CCACCATTTTAATATTTATCTCA No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data
990024370_990024378 30 Left 990024370 5:51167452-51167474 CCCTCAGCCCTTGCCAGCCACCA No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data
990024374_990024378 17 Left 990024374 5:51167465-51167487 CCAGCCACCATTTTAATATTTAT No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data
990024376_990024378 10 Left 990024376 5:51167472-51167494 CCATTTTAATATTTATCTCAAGA No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data
990024373_990024378 22 Left 990024373 5:51167460-51167482 CCTTGCCAGCCACCATTTTAATA No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data
990024372_990024378 23 Left 990024372 5:51167459-51167481 CCCTTGCCAGCCACCATTTTAAT No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data
990024371_990024378 29 Left 990024371 5:51167453-51167475 CCTCAGCCCTTGCCAGCCACCAT No data
Right 990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990024378 Original CRISPR TCTAGGTACCCTCATAAAAG TGG Intergenic
No off target data available for this crispr