ID: 990024981

View in Genome Browser
Species Human (GRCh38)
Location 5:51176526-51176548
Sequence CTCAGGAGGCACCACTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990024981_990024985 19 Left 990024981 5:51176526-51176548 CCAACACAGTGGTGCCTCCTGAG No data
Right 990024985 5:51176568-51176590 AAAATTATCACTGTATACCAAGG No data
990024981_990024984 -6 Left 990024981 5:51176526-51176548 CCAACACAGTGGTGCCTCCTGAG No data
Right 990024984 5:51176543-51176565 CCTGAGAATAAAATGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990024981 Original CRISPR CTCAGGAGGCACCACTGTGT TGG (reversed) Intergenic