ID: 990026319

View in Genome Browser
Species Human (GRCh38)
Location 5:51194854-51194876
Sequence GTCTGATCCATTGTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990026315_990026319 16 Left 990026315 5:51194815-51194837 CCCCAGCACTTCAGAGTGATTTA No data
Right 990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG No data
990026316_990026319 15 Left 990026316 5:51194816-51194838 CCCAGCACTTCAGAGTGATTTAT No data
Right 990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG No data
990026313_990026319 18 Left 990026313 5:51194813-51194835 CCCCCCAGCACTTCAGAGTGATT No data
Right 990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG No data
990026317_990026319 14 Left 990026317 5:51194817-51194839 CCAGCACTTCAGAGTGATTTATG No data
Right 990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG No data
990026312_990026319 22 Left 990026312 5:51194809-51194831 CCTACCCCCCAGCACTTCAGAGT No data
Right 990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG No data
990026314_990026319 17 Left 990026314 5:51194814-51194836 CCCCCAGCACTTCAGAGTGATTT No data
Right 990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990026319 Original CRISPR GTCTGATCCATTGTGCTGAC TGG Intergenic
No off target data available for this crispr