ID: 990037392

View in Genome Browser
Species Human (GRCh38)
Location 5:51338340-51338362
Sequence TTATATACAAATGTAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990037392_990037395 26 Left 990037392 5:51338340-51338362 CCTACCTCTACATTTGTATATAA No data
Right 990037395 5:51338389-51338411 TGTCCTTGTCCCCGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990037392 Original CRISPR TTATATACAAATGTAGAGGT AGG (reversed) Intergenic
No off target data available for this crispr