ID: 990038122

View in Genome Browser
Species Human (GRCh38)
Location 5:51348074-51348096
Sequence GACTTATATTTTCAACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990038121_990038122 -5 Left 990038121 5:51348056-51348078 CCTCTAACTTTAACTCTAGACTT No data
Right 990038122 5:51348074-51348096 GACTTATATTTTCAACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990038122 Original CRISPR GACTTATATTTTCAACTGCT TGG Intergenic
No off target data available for this crispr