ID: 990039570 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:51363021-51363043 |
Sequence | CCTTCCTTATGGAAGCTTAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
990039570_990039578 | 30 | Left | 990039570 | 5:51363021-51363043 | CCCCTAAGCTTCCATAAGGAAGG | No data | ||
Right | 990039578 | 5:51363074-51363096 | TTTTCTTTTTTTTTTTTAGATGG | 0: 94 1: 4456 2: 95811 3: 78767 4: 120750 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
990039570 | Original CRISPR | CCTTCCTTATGGAAGCTTAG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |