ID: 990039570

View in Genome Browser
Species Human (GRCh38)
Location 5:51363021-51363043
Sequence CCTTCCTTATGGAAGCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990039570_990039578 30 Left 990039570 5:51363021-51363043 CCCCTAAGCTTCCATAAGGAAGG No data
Right 990039578 5:51363074-51363096 TTTTCTTTTTTTTTTTTAGATGG 0: 94
1: 4456
2: 95811
3: 78767
4: 120750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990039570 Original CRISPR CCTTCCTTATGGAAGCTTAG GGG (reversed) Intergenic
No off target data available for this crispr