ID: 990047262

View in Genome Browser
Species Human (GRCh38)
Location 5:51448350-51448372
Sequence AAAAATGAACAGATGAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990047262_990047263 10 Left 990047262 5:51448350-51448372 CCAAGGTTCATCTGTTCATTTTT No data
Right 990047263 5:51448383-51448405 TGATTAATGTTAGTCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990047262 Original CRISPR AAAAATGAACAGATGAACCT TGG (reversed) Intergenic
No off target data available for this crispr