ID: 990053479

View in Genome Browser
Species Human (GRCh38)
Location 5:51538656-51538678
Sequence CCCATCGAAGGTTCTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990053479_990053484 6 Left 990053479 5:51538656-51538678 CCTTTCCTAGAACCTTCGATGGG No data
Right 990053484 5:51538685-51538707 CGCCTATTTGGCCATCTTGCTGG No data
990053479_990053483 -6 Left 990053479 5:51538656-51538678 CCTTTCCTAGAACCTTCGATGGG No data
Right 990053483 5:51538673-51538695 GATGGGAGCATGCGCCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990053479 Original CRISPR CCCATCGAAGGTTCTAGGAA AGG (reversed) Intergenic