ID: 990053479 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:51538656-51538678 |
| Sequence | CCCATCGAAGGTTCTAGGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990053479_990053484 | 6 | Left | 990053479 | 5:51538656-51538678 | CCTTTCCTAGAACCTTCGATGGG | No data | ||
| Right | 990053484 | 5:51538685-51538707 | CGCCTATTTGGCCATCTTGCTGG | No data | ||||
| 990053479_990053483 | -6 | Left | 990053479 | 5:51538656-51538678 | CCTTTCCTAGAACCTTCGATGGG | No data | ||
| Right | 990053483 | 5:51538673-51538695 | GATGGGAGCATGCGCCTATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990053479 | Original CRISPR | CCCATCGAAGGTTCTAGGAA AGG (reversed) | Intergenic | ||