ID: 990072487

View in Genome Browser
Species Human (GRCh38)
Location 5:51801507-51801529
Sequence AGAATACCTCCTACTAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072487_990072497 26 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072497 5:51801556-51801578 AGACCATAGGGTATAGGCGGGGG No data
990072487_990072496 25 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072496 5:51801555-51801577 GAGACCATAGGGTATAGGCGGGG No data
990072487_990072493 20 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072493 5:51801550-51801572 AGACTGAGACCATAGGGTATAGG No data
990072487_990072495 24 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072495 5:51801554-51801576 TGAGACCATAGGGTATAGGCGGG No data
990072487_990072491 13 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072491 5:51801543-51801565 AACAAACAGACTGAGACCATAGG No data
990072487_990072492 14 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072492 5:51801544-51801566 ACAAACAGACTGAGACCATAGGG No data
990072487_990072494 23 Left 990072487 5:51801507-51801529 CCAGCCTTAGTAGGAGGTATTCT No data
Right 990072494 5:51801553-51801575 CTGAGACCATAGGGTATAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990072487 Original CRISPR AGAATACCTCCTACTAAGGC TGG (reversed) Intergenic
No off target data available for this crispr