ID: 990072853

View in Genome Browser
Species Human (GRCh38)
Location 5:51806459-51806481
Sequence AGGGATATAGAAGGAGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072853_990072858 8 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072858 5:51806490-51806512 GATGATGACTTCAAATTTGAAGG No data
990072853_990072859 9 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG No data
990072853_990072860 13 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data
990072853_990072861 14 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990072853 Original CRISPR AGGGATATAGAAGGAGACCA TGG (reversed) Intergenic