ID: 990072855

View in Genome Browser
Species Human (GRCh38)
Location 5:51806478-51806500
Sequence AAGTCATCATCTGGAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072855_990072860 -6 Left 990072855 5:51806478-51806500 CCCTATTCTCCAGATGATGACTT No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data
990072855_990072859 -10 Left 990072855 5:51806478-51806500 CCCTATTCTCCAGATGATGACTT No data
Right 990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG No data
990072855_990072861 -5 Left 990072855 5:51806478-51806500 CCCTATTCTCCAGATGATGACTT No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990072855 Original CRISPR AAGTCATCATCTGGAGAATA GGG (reversed) Intergenic