ID: 990072858 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:51806490-51806512 |
| Sequence | GATGATGACTTCAAATTTGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990072852_990072858 | 9 | Left | 990072852 | 5:51806458-51806480 | CCCATGGTCTCCTTCTATATCCC | No data | ||
| Right | 990072858 | 5:51806490-51806512 | GATGATGACTTCAAATTTGAAGG | No data | ||||
| 990072853_990072858 | 8 | Left | 990072853 | 5:51806459-51806481 | CCATGGTCTCCTTCTATATCCCT | No data | ||
| Right | 990072858 | 5:51806490-51806512 | GATGATGACTTCAAATTTGAAGG | No data | ||||
| 990072854_990072858 | -1 | Left | 990072854 | 5:51806468-51806490 | CCTTCTATATCCCTATTCTCCAG | No data | ||
| Right | 990072858 | 5:51806490-51806512 | GATGATGACTTCAAATTTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990072858 | Original CRISPR | GATGATGACTTCAAATTTGA AGG | Intergenic | ||