ID: 990072858

View in Genome Browser
Species Human (GRCh38)
Location 5:51806490-51806512
Sequence GATGATGACTTCAAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072852_990072858 9 Left 990072852 5:51806458-51806480 CCCATGGTCTCCTTCTATATCCC No data
Right 990072858 5:51806490-51806512 GATGATGACTTCAAATTTGAAGG No data
990072853_990072858 8 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072858 5:51806490-51806512 GATGATGACTTCAAATTTGAAGG No data
990072854_990072858 -1 Left 990072854 5:51806468-51806490 CCTTCTATATCCCTATTCTCCAG No data
Right 990072858 5:51806490-51806512 GATGATGACTTCAAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990072858 Original CRISPR GATGATGACTTCAAATTTGA AGG Intergenic