ID: 990072859

View in Genome Browser
Species Human (GRCh38)
Location 5:51806491-51806513
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072854_990072859 0 Left 990072854 5:51806468-51806490 CCTTCTATATCCCTATTCTCCAG No data
Right 990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG No data
990072855_990072859 -10 Left 990072855 5:51806478-51806500 CCCTATTCTCCAGATGATGACTT No data
Right 990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG No data
990072852_990072859 10 Left 990072852 5:51806458-51806480 CCCATGGTCTCCTTCTATATCCC No data
Right 990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG No data
990072853_990072859 9 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr