ID: 990072860

View in Genome Browser
Species Human (GRCh38)
Location 5:51806495-51806517
Sequence TGACTTCAAATTTGAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072855_990072860 -6 Left 990072855 5:51806478-51806500 CCCTATTCTCCAGATGATGACTT No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data
990072854_990072860 4 Left 990072854 5:51806468-51806490 CCTTCTATATCCCTATTCTCCAG No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data
990072856_990072860 -7 Left 990072856 5:51806479-51806501 CCTATTCTCCAGATGATGACTTC No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data
990072852_990072860 14 Left 990072852 5:51806458-51806480 CCCATGGTCTCCTTCTATATCCC No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data
990072853_990072860 13 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072860 5:51806495-51806517 TGACTTCAAATTTGAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990072860 Original CRISPR TGACTTCAAATTTGAAGGGC AGG Intergenic