ID: 990072861

View in Genome Browser
Species Human (GRCh38)
Location 5:51806496-51806518
Sequence GACTTCAAATTTGAAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990072854_990072861 5 Left 990072854 5:51806468-51806490 CCTTCTATATCCCTATTCTCCAG No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data
990072855_990072861 -5 Left 990072855 5:51806478-51806500 CCCTATTCTCCAGATGATGACTT No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data
990072852_990072861 15 Left 990072852 5:51806458-51806480 CCCATGGTCTCCTTCTATATCCC No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data
990072856_990072861 -6 Left 990072856 5:51806479-51806501 CCTATTCTCCAGATGATGACTTC No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data
990072853_990072861 14 Left 990072853 5:51806459-51806481 CCATGGTCTCCTTCTATATCCCT No data
Right 990072861 5:51806496-51806518 GACTTCAAATTTGAAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990072861 Original CRISPR GACTTCAAATTTGAAGGGCA GGG Intergenic