ID: 990075844

View in Genome Browser
Species Human (GRCh38)
Location 5:51844583-51844605
Sequence CAAAATGCCAATAGGGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990075844_990075850 5 Left 990075844 5:51844583-51844605 CCTATATCCCTATTGGCATTTTG No data
Right 990075850 5:51844611-51844633 AGCCATTCAACAAGTCTGTAGGG No data
990075844_990075849 4 Left 990075844 5:51844583-51844605 CCTATATCCCTATTGGCATTTTG No data
Right 990075849 5:51844610-51844632 AAGCCATTCAACAAGTCTGTAGG 0: 33
1: 1539
2: 1929
3: 1355
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990075844 Original CRISPR CAAAATGCCAATAGGGATAT AGG (reversed) Intergenic
No off target data available for this crispr