ID: 990080324

View in Genome Browser
Species Human (GRCh38)
Location 5:51904571-51904593
Sequence ATGGATAATACCACATATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990080324_990080326 5 Left 990080324 5:51904571-51904593 CCTACATATGTGGTATTATCCAT No data
Right 990080326 5:51904599-51904621 TTACAATTAAATGTACATAATGG No data
990080324_990080327 18 Left 990080324 5:51904571-51904593 CCTACATATGTGGTATTATCCAT No data
Right 990080327 5:51904612-51904634 TACATAATGGAAGTAATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990080324 Original CRISPR ATGGATAATACCACATATGT AGG (reversed) Intergenic
No off target data available for this crispr