ID: 990081033

View in Genome Browser
Species Human (GRCh38)
Location 5:51913804-51913826
Sequence TTGACATTTCCCCTTTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990081033_990081036 16 Left 990081033 5:51913804-51913826 CCAGAAGAAAGGGGAAATGTCAA No data
Right 990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG No data
990081033_990081037 17 Left 990081033 5:51913804-51913826 CCAGAAGAAAGGGGAAATGTCAA No data
Right 990081037 5:51913844-51913866 TGTTCTTGTCAAAGTGGCCTGGG No data
990081033_990081035 11 Left 990081033 5:51913804-51913826 CCAGAAGAAAGGGGAAATGTCAA No data
Right 990081035 5:51913838-51913860 ATGCTCTGTTCTTGTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990081033 Original CRISPR TTGACATTTCCCCTTTCTTC TGG (reversed) Intergenic
No off target data available for this crispr