ID: 990081034

View in Genome Browser
Species Human (GRCh38)
Location 5:51913830-51913852
Sequence ACAAGAACAGAGCATACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990081034_990081038 6 Left 990081034 5:51913830-51913852 CCTCTTGTATGCTCTGTTCTTGT No data
Right 990081038 5:51913859-51913881 GGCCTGGGCTGAGCAGCAAAAGG No data
990081034_990081041 13 Left 990081034 5:51913830-51913852 CCTCTTGTATGCTCTGTTCTTGT No data
Right 990081041 5:51913866-51913888 GCTGAGCAGCAAAAGGGTCCAGG No data
990081034_990081039 7 Left 990081034 5:51913830-51913852 CCTCTTGTATGCTCTGTTCTTGT No data
Right 990081039 5:51913860-51913882 GCCTGGGCTGAGCAGCAAAAGGG No data
990081034_990081037 -9 Left 990081034 5:51913830-51913852 CCTCTTGTATGCTCTGTTCTTGT No data
Right 990081037 5:51913844-51913866 TGTTCTTGTCAAAGTGGCCTGGG No data
990081034_990081036 -10 Left 990081034 5:51913830-51913852 CCTCTTGTATGCTCTGTTCTTGT No data
Right 990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990081034 Original CRISPR ACAAGAACAGAGCATACAAG AGG (reversed) Intergenic
No off target data available for this crispr