ID: 990082002

View in Genome Browser
Species Human (GRCh38)
Location 5:51928480-51928502
Sequence ATGCCCTTCTAGAAGATCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990082002_990082004 2 Left 990082002 5:51928480-51928502 CCTTCGATCTTCTAGAAGGGCAT No data
Right 990082004 5:51928505-51928527 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254
990082002_990082005 7 Left 990082002 5:51928480-51928502 CCTTCGATCTTCTAGAAGGGCAT No data
Right 990082005 5:51928510-51928532 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111
990082002_990082007 18 Left 990082002 5:51928480-51928502 CCTTCGATCTTCTAGAAGGGCAT No data
Right 990082007 5:51928521-51928543 TCCATGGTTTGGAATAAAAGAGG 0: 8
1: 29
2: 32
3: 52
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990082002 Original CRISPR ATGCCCTTCTAGAAGATCGA AGG (reversed) Intergenic
No off target data available for this crispr