ID: 990083539

View in Genome Browser
Species Human (GRCh38)
Location 5:51945808-51945830
Sequence TTCTTCAGAGATTGGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990083539_990083546 26 Left 990083539 5:51945808-51945830 CCATCCTACCAATCTCTGAAGAA No data
Right 990083546 5:51945857-51945879 CCATGACTGTAAATTTCCTGAGG 0: 39
1: 1092
2: 7290
3: 8426
4: 6468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990083539 Original CRISPR TTCTTCAGAGATTGGTAGGA TGG (reversed) Intergenic
No off target data available for this crispr