ID: 990085223

View in Genome Browser
Species Human (GRCh38)
Location 5:51968509-51968531
Sequence GAAGAGTTCAGAGTTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990085215_990085223 8 Left 990085215 5:51968478-51968500 CCCAAGTCTGGCAGTTGGGCTGG No data
Right 990085223 5:51968509-51968531 GAAGAGTTCAGAGTTGGCTGGGG No data
990085217_990085223 7 Left 990085217 5:51968479-51968501 CCAAGTCTGGCAGTTGGGCTGGT No data
Right 990085223 5:51968509-51968531 GAAGAGTTCAGAGTTGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990085223 Original CRISPR GAAGAGTTCAGAGTTGGCTG GGG Intergenic
No off target data available for this crispr