ID: 990086943

View in Genome Browser
Species Human (GRCh38)
Location 5:51990263-51990285
Sequence CTCAATGAGAATGTAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990086943_990086947 22 Left 990086943 5:51990263-51990285 CCTTTCTTTACATTCTCATTGAG No data
Right 990086947 5:51990308-51990330 ACAGTGACACATGCACGGAGAGG No data
990086943_990086946 17 Left 990086943 5:51990263-51990285 CCTTTCTTTACATTCTCATTGAG No data
Right 990086946 5:51990303-51990325 TGTGGACAGTGACACATGCACGG No data
990086943_990086945 -1 Left 990086943 5:51990263-51990285 CCTTTCTTTACATTCTCATTGAG No data
Right 990086945 5:51990285-51990307 GTCTGTGGCTTTAAGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990086943 Original CRISPR CTCAATGAGAATGTAAAGAA AGG (reversed) Intergenic
No off target data available for this crispr