ID: 990087211

View in Genome Browser
Species Human (GRCh38)
Location 5:51993576-51993598
Sequence TCGACATCTAATAACATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990087211_990087212 -5 Left 990087211 5:51993576-51993598 CCAGAAATGTTATTAGATGTCGA No data
Right 990087212 5:51993594-51993616 GTCGATTACGATTCTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990087211 Original CRISPR TCGACATCTAATAACATTTC TGG (reversed) Intergenic
No off target data available for this crispr