ID: 990088016

View in Genome Browser
Species Human (GRCh38)
Location 5:52003034-52003056
Sequence ACTGCCTCCACCATAAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990088016_990088020 18 Left 990088016 5:52003034-52003056 CCATATTTTATGGTGGAGGCAGT No data
Right 990088020 5:52003075-52003097 CTTGATACTACCTCTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990088016 Original CRISPR ACTGCCTCCACCATAAAATA TGG (reversed) Intergenic
No off target data available for this crispr