ID: 990089797

View in Genome Browser
Species Human (GRCh38)
Location 5:52028933-52028955
Sequence ATTCATTTCAGCATCTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990089797 Original CRISPR ATTCATTTCAGCATCTATTT GGG (reversed) Intronic
902424537 1:16309407-16309429 ATTTATTTCAGCATCATTTTTGG - Intronic
904992068 1:34601033-34601055 TTACATCTCAGCATCTACTTTGG + Intergenic
905154436 1:35963192-35963214 ATTCATTTCAACATTGTTTTTGG + Intronic
905337700 1:37256811-37256833 ATTCATTTCAGCAGCTATTAGGG + Intergenic
905930185 1:41781387-41781409 TTTCATTTCAGCAGCAATTATGG - Intronic
906919043 1:50043772-50043794 ATTCATTTCAACATCTCCTAAGG - Intergenic
906997188 1:50809253-50809275 CTTCATTTCAGCTTTGATTTTGG - Intronic
908945901 1:69496588-69496610 ATTGATTTATGCATATATTTGGG - Intergenic
909300094 1:74002235-74002257 AAAGATTTCAGCATCTTTTTTGG + Intergenic
909933417 1:81524433-81524455 ATTAATTTGAGAATCTATTTAGG + Intronic
910163623 1:84299373-84299395 AGTTATTTCAGCATATAATTTGG + Intronic
911562950 1:99428856-99428878 ATTTCTTTCAGTATTTATTTAGG - Intergenic
912003369 1:104861803-104861825 CTTCATTTCACTATCTCTTTAGG - Intergenic
913118099 1:115714948-115714970 ATTCATTACAGCAGCAATCTCGG + Intronic
914202729 1:145500855-145500877 ATTCAGTTCAGCACTGATTTTGG - Intergenic
914236659 1:145818783-145818805 ATTCAGTTCAGCACTGATTTTGG - Intronic
914481852 1:148074006-148074028 ATTCAGTTCAGCACTGATTTTGG - Intergenic
916533034 1:165676606-165676628 ATGCATTTCAGAAGCTATCTTGG - Intronic
916995430 1:170292507-170292529 ATCCCTTTCAACAACTATTTGGG + Intergenic
917871019 1:179241796-179241818 GTTGCTTTCAGCCTCTATTTTGG - Intergenic
918026269 1:180750883-180750905 ATACACTTCTGCATTTATTTAGG + Intronic
918524957 1:185455308-185455330 ATTCATTGGAGTTTCTATTTAGG - Intergenic
918620027 1:186592742-186592764 ATTCAGTTCAGCTCCAATTTTGG - Intergenic
919141639 1:193580155-193580177 TTTCATTTCAGGATATAATTTGG - Intergenic
919204300 1:194400958-194400980 ATACATTTCCGCATACATTTTGG + Intergenic
919651358 1:200152170-200152192 TAGCATTTCAGCATCAATTTGGG + Intronic
920714483 1:208326813-208326835 TTTCAATTCATCATCTTTTTTGG - Intergenic
921087883 1:211813202-211813224 ATTCATTTCATTATCTCTTGGGG + Intronic
921322674 1:213957932-213957954 ATTCAGTTTACCATCTAGTTGGG + Intergenic
921601105 1:217107663-217107685 ATACATTTCAGCATTAAGTTTGG - Intronic
924389838 1:243542039-243542061 ATTTATTTCTCCATTTATTTAGG - Intronic
1062901333 10:1148954-1148976 CTTCAGGTCAGCATCTAATTGGG - Intergenic
1063395211 10:5680598-5680620 ATACTTTTCTGCATCTATTGAGG - Intergenic
1064056538 10:12102550-12102572 AAACATTTCAGTATCTAGTTTGG - Intronic
1064739673 10:18419877-18419899 ATTGATTTCAGCAAGAATTTAGG + Intronic
1065700318 10:28418890-28418912 ATTCATTTCAGAATTTATCTTGG + Intergenic
1066020062 10:31289582-31289604 ATAGGTTTCAGCATCAATTTTGG - Intergenic
1066754663 10:38699169-38699191 ATGCTTTTCTGCATCTATTGAGG - Intergenic
1066805452 10:39246572-39246594 TTTCATTTCAACATGTAGTTTGG + Intergenic
1067351322 10:45478663-45478685 TTTCATTTCAGATTTTATTTAGG - Intronic
1068021223 10:51587295-51587317 ATTCATTACAGCTTCGCTTTAGG - Intronic
1068139017 10:52980985-52981007 TTTCATTTAAGGATTTATTTTGG + Intergenic
1068288413 10:54969990-54970012 TTACATTTCAGCATGAATTTTGG - Intronic
1069109155 10:64423272-64423294 ATTCATTTCAGTGTCTTTCTAGG + Intergenic
1069612913 10:69787231-69787253 ATCCAATTCAGCAACTAGTTTGG + Intergenic
1071092464 10:81934971-81934993 ATTCATTGCAACATGTGTTTTGG - Intronic
1071401983 10:85282026-85282048 GTTTATTTCTGCATCCATTTGGG + Intergenic
1071739739 10:88343687-88343709 ATATATTTCAGGATCTGTTTGGG + Intronic
1072382698 10:94891899-94891921 ATTCATTTCAGAATCCAGTTTGG - Intergenic
1074539698 10:114354127-114354149 ATCCATTTCATCAGCTATTTTGG - Intronic
1074608472 10:114997931-114997953 ATTCAATTCAGCAACAATTAGGG + Intergenic
1074937284 10:118194047-118194069 ATTCTTTCCAGTATCAATTTGGG + Intergenic
1076130345 10:128009693-128009715 ATTCTTTTCAGCATCTTTCAGGG - Intronic
1076409405 10:130235075-130235097 ATTCATTGCAGCAGCTATAGAGG - Intergenic
1077856164 11:6128394-6128416 TTTTATCTTAGCATCTATTTTGG + Intergenic
1077978712 11:7276672-7276694 ATTCTTTTAAGCATCAGTTTTGG + Intronic
1079276919 11:19048322-19048344 AATCCTTTCTGCATCTATTCAGG - Intergenic
1079640239 11:22796013-22796035 TTTCATTGCAGAATCTATTTGGG - Intronic
1079911961 11:26321369-26321391 TTTCTTTTCAGTATCTTTTTTGG + Intronic
1079937584 11:26636955-26636977 ATACACTACAGCATCTAGTTTGG + Intronic
1082652658 11:55812715-55812737 ATTTATTTCAGGATCCATTATGG + Intergenic
1084776085 11:71376743-71376765 TTACATTTCAGCATGAATTTTGG + Intergenic
1085813887 11:79714902-79714924 CTTCAGTTCAGCTTCGATTTAGG + Intergenic
1086225302 11:84501245-84501267 AAACATTTCAGAATCTACTTAGG - Intronic
1086987982 11:93270812-93270834 ATTCATTTTGACATATATTTAGG - Intergenic
1087114400 11:94509182-94509204 ATACATTTCTGCATTTATTTAGG + Intergenic
1087158019 11:94923473-94923495 ATTATTTTCAGCTTCTATTTTGG - Intergenic
1087989372 11:104729431-104729453 ATTCATTTCAACATCATCTTAGG + Intergenic
1089856400 11:121548865-121548887 ATTCAATTCAACAAATATTTAGG - Intronic
1090096473 11:123746739-123746761 ATTAATTTCAGCAGTTAATTTGG - Intergenic
1090514174 11:127407485-127407507 ACTTAGTTCAGCATCTATTTGGG + Intergenic
1090980484 11:131716302-131716324 ATTCCTTTCAACATGAATTTTGG + Intronic
1091864934 12:3824974-3824996 TTTTATTTTAGCATTTATTTTGG - Intronic
1092480848 12:8857868-8857890 AATCATTTCTTCATTTATTTGGG - Intronic
1093220014 12:16409331-16409353 ATTCCTTTCAGAATATATATAGG - Intronic
1094279866 12:28724199-28724221 ATACATTTTAGAATTTATTTAGG - Intergenic
1094437995 12:30443192-30443214 ATTTATTCCAGCATTTTTTTTGG - Intergenic
1094551973 12:31461229-31461251 ATTTATTTTAGCCTTTATTTTGG + Intronic
1094706757 12:32921874-32921896 ATCCACTTTAGCATCTAATTGGG - Intergenic
1095450116 12:42321743-42321765 ATTTATATCAGAATCTATATTGG + Intronic
1095454958 12:42373494-42373516 AATCATTTCAGCATCTTGATTGG - Intronic
1097524983 12:60721497-60721519 ATACAGTTCATCACCTATTTAGG + Intergenic
1097569582 12:61316695-61316717 ATTCTTATCACCATCTAATTGGG + Intergenic
1097800181 12:63905205-63905227 ATTCTTTTCAGCAGCCCTTTAGG - Intronic
1098734964 12:74089617-74089639 ATTTTTTTCGGCATCTGTTTGGG + Intergenic
1098753239 12:74322581-74322603 ATTCATTTATGTATGTATTTGGG - Intergenic
1098756323 12:74367843-74367865 AGTCATTTCAACAGTTATTTGGG - Intergenic
1099099561 12:78421498-78421520 GTTCATTTCAACTTCTATTTTGG + Intergenic
1099249137 12:80230852-80230874 ATTCAGTTCTGCATTCATTTAGG + Intronic
1099991374 12:89725415-89725437 AAGCTTTTCAGCATCTATTGAGG - Intergenic
1100900102 12:99229368-99229390 ATTCATTTCAGCATTGTTTATGG - Intronic
1100926676 12:99556441-99556463 ATTCAGTTCAGCTTTGATTTTGG + Intronic
1103115727 12:118329437-118329459 ATCCATTTCAGAGTCTAATTAGG + Intronic
1105711819 13:23017540-23017562 ATTCAGTTCAGCTGTTATTTTGG + Intergenic
1107117777 13:36765600-36765622 ATTCAGTTCAGTATCTAGTATGG + Intergenic
1107205772 13:37785568-37785590 TTTCATTTTAGCCTGTATTTTGG - Intronic
1107261012 13:38491149-38491171 ATTCATTTCTGGATTTACTTGGG + Intergenic
1107328041 13:39266470-39266492 ATGCATTTATGCATCTATGTAGG - Intergenic
1107712819 13:43167452-43167474 TTCCATTTCAGCAGCTATTTAGG - Intergenic
1108952425 13:56112029-56112051 ATTCATTATAGCACGTATTTTGG + Intergenic
1109059665 13:57598797-57598819 AGTTACTTCAGCATCAATTTTGG + Intergenic
1109595223 13:64544114-64544136 ATTCATTTCAGCCACTGCTTTGG + Intergenic
1109801664 13:67387135-67387157 ATTCATTTCAGCTCCAATTTTGG - Intergenic
1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG + Intergenic
1109957310 13:69585214-69585236 GTTCATTTCTGCAACTATGTTGG + Intergenic
1110038747 13:70723473-70723495 GTTTATTTCAACATCTGTTTGGG + Intergenic
1110453172 13:75660001-75660023 ATTCCTTTCTGCATTTATGTTGG + Intronic
1110482930 13:76003053-76003075 TTTCATTCCTTCATCTATTTGGG + Intergenic
1110498293 13:76195012-76195034 CTTCATTTCAGCACTGATTTTGG + Intergenic
1110920122 13:81073687-81073709 ATTCATTTAAACATTCATTTAGG - Intergenic
1111642401 13:90985179-90985201 ATTCCTTTCACAATCTATTTAGG - Intergenic
1112065892 13:95792630-95792652 AGTGCTTTCTGCATCTATTTAGG + Exonic
1112266044 13:97924688-97924710 ATACTTGTCAGCATCTCTTTAGG + Intergenic
1112868624 13:103940307-103940329 AATCATTTCAGAAACTATGTTGG + Intergenic
1114299771 14:21364915-21364937 ATGGTTTTCAGCATCAATTTAGG - Exonic
1114523781 14:23355261-23355283 ACTCATTTCAGCATCTCTTCAGG + Intergenic
1114834833 14:26191661-26191683 AGTCAATTCAGGATCTAATTAGG - Intergenic
1115015528 14:28607934-28607956 ATTCATTTCTGCATCTTTGTGGG + Intergenic
1115073198 14:29352044-29352066 TTTTGTTTCAGCTTCTATTTTGG + Intergenic
1115289550 14:31754144-31754166 ATTTATCTCACCAACTATTTAGG - Intronic
1115651690 14:35406678-35406700 ATGCATTTCAGTTTCTTTTTAGG - Intergenic
1116039729 14:39671096-39671118 ATGCATTACAGAATTTATTTAGG - Intergenic
1116128859 14:40827062-40827084 TTTCATTTCAGCTTTGATTTTGG - Intergenic
1116219779 14:42068581-42068603 ATTCATTTCAGCTCTCATTTTGG + Intergenic
1116258866 14:42595516-42595538 ATTCATTTAAGCATTACTTTGGG - Intergenic
1116614069 14:47111503-47111525 ATCCTTTTCAACTTCTATTTTGG - Intronic
1116639408 14:47441976-47441998 ATTGATTTAAGGTTCTATTTAGG + Intronic
1116690293 14:48097818-48097840 ATTAATTTCAACTTCTTTTTTGG + Intergenic
1117364046 14:55007422-55007444 ATTCAGTTCTGCATATATTTTGG - Intronic
1117794888 14:59382216-59382238 ATTCATTACTGCATGTATTTTGG + Intergenic
1117945905 14:61020730-61020752 ATTGATTTTAAGATCTATTTTGG + Intronic
1118233866 14:63981797-63981819 ATTAATTTTAGTTTCTATTTTGG - Intronic
1118466702 14:66037880-66037902 AATGATTCCAGCATCCATTTAGG - Intergenic
1118544372 14:66869991-66870013 ATCTATTTCAGCATCTAGTTCGG - Intronic
1125907999 15:43411264-43411286 ATTCATTTTAGCATCTGGCTGGG - Intronic
1126507488 15:49422933-49422955 ATTCATTTGAACATATATATAGG - Intronic
1128432651 15:67612885-67612907 ATTGATTTCAGCATTGATTTTGG + Intronic
1128950352 15:71873318-71873340 AATCATTTCCCAATCTATTTAGG + Intronic
1130680921 15:85996061-85996083 TTTAATTTCAACATTTATTTTGG - Intergenic
1130808014 15:87347533-87347555 ATTCATTGCAGTAACTGTTTTGG - Intergenic
1130840056 15:87690512-87690534 ATTCATCTCTAAATCTATTTGGG - Intergenic
1132090650 15:98945723-98945745 AGCCATTTCAACATCTATTCAGG - Intronic
1133863623 16:9620507-9620529 ATACATTTCTACATTTATTTAGG - Intergenic
1134832300 16:17333549-17333571 ATTAATTTCAACATGAATTTTGG - Intronic
1134859266 16:17546497-17546519 ATTCCTTTGGGCATCTACTTGGG - Intergenic
1134859716 16:17550381-17550403 ATTCCTTTGGGCATCTACTTGGG - Intergenic
1135196677 16:20400599-20400621 TTTTATTTCAACTTCTATTTGGG + Intronic
1135251263 16:20902154-20902176 ATTCCATTCAGCATATATTTGGG + Intronic
1135387560 16:22056842-22056864 ATGCATTTCTGATTCTATTTAGG + Intronic
1135459407 16:22628422-22628444 ATTTTTTTCAACATGTATTTAGG - Intergenic
1136521609 16:30800196-30800218 TTTCACATCAGCACCTATTTTGG - Intergenic
1136728021 16:32377677-32377699 ATGCTTTTCTGCATCTATTGAGG + Intergenic
1137232908 16:46584807-46584829 AGTTATTTCAGCAACCATTTGGG + Intronic
1137737583 16:50736469-50736491 ATTCATTTCAGCTTTTTGTTTGG - Intergenic
1137805645 16:51302842-51302864 AGTCATGTGAGCATCTTTTTAGG - Intergenic
1138215360 16:55199960-55199982 ATAAATTTCACCATATATTTTGG - Intergenic
1138258653 16:55595822-55595844 ATTCAGTTCAGCTTTGATTTTGG - Intergenic
1138911994 16:61412164-61412186 CTTCATTTCAACTTGTATTTTGG + Intergenic
1138915986 16:61465326-61465348 TTTCATTTCATGAGCTATTTTGG + Intergenic
1140630199 16:76843042-76843064 ATTCAGTTTAGCTTTTATTTTGG + Intergenic
1141789123 16:86221446-86221468 ATTCATTGCAGCATTGTTTTTGG + Intergenic
1141985918 16:87579871-87579893 ATTCATGTCAACATCTATAGTGG - Intergenic
1202998418 16_KI270728v1_random:140077-140099 ATGCTTTTCTGCATCTATTGAGG - Intergenic
1203130011 16_KI270728v1_random:1676481-1676503 ATGCTTTTCTGCATCTATTGAGG - Intergenic
1144102857 17:11959615-11959637 ATTCATTTCAGCAGATCCTTAGG + Intronic
1145720660 17:27068934-27068956 ATTCATGTCACTAGCTATTTAGG + Intergenic
1146965556 17:37025836-37025858 ATTGATTTTAGCATCTATTGTGG - Intronic
1147368505 17:39975083-39975105 ATTCATTTATTCATCCATTTGGG - Intronic
1147417236 17:40301241-40301263 CTTCATTTCTGCATCTCTCTAGG + Intronic
1149133640 17:53339341-53339363 ATTCACTTCAGCTCCAATTTTGG - Intergenic
1149360170 17:55886935-55886957 ATTCAGTTTAGCATTTGTTTTGG - Intergenic
1149697104 17:58624649-58624671 TTTCATTTAAGAATCTATCTTGG + Intronic
1151106515 17:71622336-71622358 ATTCATTTTGGCATATACTTTGG - Intergenic
1153067515 18:1062988-1063010 ATTCGTTTCAGGATCTACTGTGG + Intergenic
1153319469 18:3758162-3758184 CTTCATTTCAGCATCATTATTGG + Intronic
1153391923 18:4572167-4572189 ATAAAATTCAGCATCTCTTTGGG - Intergenic
1153786357 18:8538507-8538529 TTCCATTTCATCATCTAATTTGG + Intergenic
1155277692 18:24204850-24204872 CTTCATTCCAGCTTCTATCTCGG + Intronic
1155923175 18:31626180-31626202 ATTCCCTTCAGCAGCTTTTTTGG + Intronic
1156077523 18:33298653-33298675 ATACAGGGCAGCATCTATTTTGG + Intronic
1156575860 18:38314142-38314164 ACTCATTTCTGCTTATATTTTGG + Intergenic
1157647954 18:49296392-49296414 ATTCATTTCATCATTTATTAAGG + Intronic
1158291204 18:55946303-55946325 ATACATTTCAGCATCTTTTTTGG - Intergenic
1158365912 18:56735496-56735518 CTACACTCCAGCATCTATTTAGG - Intronic
1159333648 18:67034907-67034929 ATACATTTAAGCATCTATTGTGG - Intergenic
1159894802 18:73985971-73985993 AGTCATTTCAGGCTATATTTTGG - Intergenic
1163341102 19:16707730-16707752 CTTCTTTTCACTATCTATTTTGG + Intergenic
1164235975 19:23334895-23334917 ATGCATTTTAGTAACTATTTAGG - Intronic
1164284142 19:23796194-23796216 AGCCTTTTCAGCATCTATTGAGG + Intronic
1165804829 19:38573788-38573810 ATGCATTACAGCATCTGTGTGGG + Intronic
1166190987 19:41176409-41176431 AATCAGTTCTGCATCTATCTGGG - Intergenic
1167714673 19:51134727-51134749 ATTCATTTCAGCTCTGATTTTGG + Intronic
1167823482 19:51951208-51951230 ATCCATTTTAGCATATATTAGGG - Intergenic
926929221 2:18020100-18020122 ATTCAGTTCAGCTTTGATTTTGG + Intronic
927362962 2:22258442-22258464 ATGCTTTTCTGCATTTATTTGGG + Intergenic
928715907 2:34060233-34060255 TTTTATTTCAGCATATACTTGGG - Intergenic
928936795 2:36687781-36687803 ATTCATGACACCATCTTTTTTGG + Intergenic
930194269 2:48493816-48493838 ATTCTGTTCTTCATCTATTTTGG + Intronic
931181243 2:59903012-59903034 ATTTATTTGGGCATTTATTTTGG - Intergenic
933488750 2:82957446-82957468 ATTCATATAAGCATCTCTTAGGG + Intergenic
933503426 2:83146002-83146024 ATTAATTAGAGCATGTATTTAGG + Intergenic
933623084 2:84566826-84566848 ATACATTTCTACATGTATTTTGG - Intronic
934479298 2:94620265-94620287 ATTTATCTCAGTATCTATTATGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936827405 2:116599183-116599205 TTTCATTTCAGCATCTGCTTTGG + Intergenic
936854708 2:116942876-116942898 AATCATTTCAGCAATTATATGGG + Intergenic
939403102 2:141720365-141720387 ATTCATTTTACCATATATTCAGG - Intronic
941331059 2:164177920-164177942 ATTCATTTCACCATAGAGTTAGG + Intergenic
941566263 2:167112160-167112182 ATTCATTTCAGCTCTGATTTTGG + Intronic
941680958 2:168398817-168398839 ATTCATTTCAGCCCTGATTTTGG + Intergenic
941750596 2:169131345-169131367 ACTCTTCTCAGCATCAATTTAGG + Intronic
942637303 2:178021489-178021511 ATTCATTTATGCCTCAATTTGGG - Intronic
943442747 2:187945827-187945849 ATTTATTGCAGCATGTATTAGGG - Intergenic
943908153 2:193527640-193527662 ATTCATTTAAGCAGTTTTTTTGG - Intergenic
944756418 2:202766766-202766788 AGCCATTTCAGGATCTCTTTGGG - Exonic
945084543 2:206117923-206117945 ATTCATCTCAGTATCTCTTTAGG + Intronic
945263733 2:207869708-207869730 ATTCTTTTCACCATCATTTTAGG + Intronic
945529848 2:210938665-210938687 ATTCATTTCATCTTCCATTTTGG - Intergenic
945773816 2:214079877-214079899 ATTATTTTAAGCAGCTATTTAGG + Intronic
946769123 2:223070219-223070241 ATTCTTCTCTGCATCTTTTTTGG - Intronic
948080857 2:235203961-235203983 CTCCTTCTCAGCATCTATTTTGG - Intergenic
948669353 2:239558102-239558124 ATTCATTTCAACATGTCTTGAGG + Intergenic
1168799927 20:638004-638026 AGTCATTTCAGTATCACTTTGGG - Intergenic
1169352175 20:4877290-4877312 ATATATTTCAGCATTTTTTTTGG + Intronic
1170089183 20:12571349-12571371 ATTTATTTATGCATATATTTAGG + Intergenic
1170271713 20:14534616-14534638 TTTCAATTGAGCATCTACTTTGG + Intronic
1170419309 20:16176665-16176687 AATCATTTCATCATCTTTCTTGG - Intergenic
1171406235 20:24914030-24914052 ATTCTTAACAGAATCTATTTAGG + Intergenic
1173758287 20:45537771-45537793 TTTCATTTCTTCCTCTATTTTGG - Intronic
1175638866 20:60609989-60610011 ATTCTTTTTACCATCAATTTAGG - Intergenic
1176990895 21:15495025-15495047 TTTCATATCAGTAACTATTTAGG - Intergenic
1177520435 21:22214734-22214756 ATTAAATTCAACACCTATTTAGG + Intergenic
1177669451 21:24207679-24207701 CTTCATTTCAGCATTTAAATAGG - Intergenic
1178571343 21:33739993-33740015 ATTCATTCTAGCCTGTATTTTGG + Intronic
1178586163 21:33873212-33873234 CTCCATTTGAGCATCTACTTAGG + Intronic
1179121622 21:38551345-38551367 ATTCAGTTCAGCCCCGATTTTGG + Intronic
1180306123 22:11127080-11127102 ATTCTTTTCTGCATCTATTGAGG - Intergenic
1180544642 22:16489263-16489285 ATTCTTTTCTGCATCTATTGAGG - Intergenic
1182066558 22:27435391-27435413 AATCATCTCAGGATCTTTTTCGG + Intergenic
1182949504 22:34359244-34359266 ATTCATTTTTGCATCTATTGAGG - Intergenic
1184096072 22:42317193-42317215 ATTCATTTCAGCAAATGTTGAGG - Intronic
1184157963 22:42681139-42681161 ATTTATTTCAGCATTGATGTTGG + Intergenic
949326745 3:2874637-2874659 ATTCACTTCAGTTTCAATTTTGG + Intronic
949905539 3:8855531-8855553 ATTCACTTCAGCATCCATTGGGG + Intronic
950259020 3:11530554-11530576 ATTCATTTCACCATCAAGTCTGG - Intronic
950978308 3:17274287-17274309 AAAAATTTCAGCATATATTTAGG - Intronic
951980067 3:28555971-28555993 CTTCATTTCAGCTCCGATTTTGG + Intergenic
952000772 3:28783402-28783424 TTTCATTTCAGCTTCCATTTTGG + Intergenic
952071708 3:29645045-29645067 AATGATTCCAGCATCTATTAGGG + Intronic
952182950 3:30938022-30938044 ATTTTTTTCTGCATCTATTGAGG + Intergenic
952443306 3:33355342-33355364 ATCCATTTCAAAATTTATTTAGG - Intronic
952623202 3:35370808-35370830 ATTCAGTTCAGCTCCGATTTTGG - Intergenic
952681651 3:36100269-36100291 TTTCATTTCATCAGCTATCTCGG + Intergenic
953087292 3:39682170-39682192 ATTTATTTCATCATCTGTTTGGG - Intergenic
953593038 3:44278698-44278720 TTTCATTTCAGATTTTATTTGGG + Intronic
954771349 3:52972552-52972574 ATTTATTTTATCATTTATTTTGG + Intronic
955567946 3:60269947-60269969 ATTCTTTTAAGTATCTATTCAGG + Intronic
956937882 3:74124621-74124643 CTTCATTTCTGGATGTATTTTGG - Intergenic
957225952 3:77446866-77446888 ATTGATTTTAACAACTATTTAGG - Intronic
957334362 3:78808174-78808196 TCTCATTTCAGCATTAATTTTGG - Intronic
957502673 3:81077479-81077501 GTTCCTTTCAGCATATATTAGGG - Intergenic
957604548 3:82380358-82380380 ATTTTATTCAGCATATATTTGGG + Intergenic
957826961 3:85459574-85459596 GTTTATTTCAGCATCTGGTTAGG - Intronic
957913464 3:86654327-86654349 ATTCATTTTAGTATTCATTTTGG + Intergenic
958889228 3:99764825-99764847 ATTGATTTAAGCACCTATATTGG - Intronic
960001740 3:112739437-112739459 AAGCATTTCAGGAGCTATTTTGG - Intergenic
960114080 3:113875348-113875370 ATTCATTCCTTCATCTACTTTGG - Intronic
961268973 3:125673059-125673081 CTTTATTTCAGGATCTGTTTGGG - Intergenic
961444778 3:126974408-126974430 ACATATTTAAGCATCTATTTTGG + Intergenic
961912019 3:130327418-130327440 ATGGATTTCAGCTTCTGTTTGGG + Intergenic
962416427 3:135186824-135186846 AATAATTTCAGCAGCTATCTGGG + Intronic
963706404 3:148693601-148693623 AGTCTTTTCAGCATCCAGTTAGG - Intergenic
963847002 3:150169636-150169658 ATTCACTCCAGCATCAATTCAGG - Intergenic
964019527 3:151992119-151992141 CTTCATGTCAGCAACCATTTTGG - Intergenic
964287830 3:155139537-155139559 ACTCATTTCAGCCACTAGTTGGG + Intronic
964580289 3:158226841-158226863 ATACATTTCAACATCATTTTGGG - Intronic
965283221 3:166781306-166781328 ATTCATTACAGAGACTATTTTGG - Intergenic
965619351 3:170626881-170626903 ATTCATTTCATTGTTTATTTTGG + Intronic
965945237 3:174232569-174232591 ATTCATTTCTGTAAGTATTTGGG - Intronic
966239210 3:177737381-177737403 TTTCATTTTTGCATTTATTTAGG + Intergenic
966256977 3:177928101-177928123 ATCCATTTAAGCATCAAATTGGG + Intergenic
966560835 3:181318156-181318178 ATTAATTACAGCTTCTAATTCGG - Intergenic
966609710 3:181856250-181856272 AATCATTTCTGCATGTATCTAGG + Intergenic
967328422 3:188265925-188265947 ATACATTTCAGAGTCTTTTTAGG + Intronic
967580607 3:191148816-191148838 CTTCAGTTCAGCTTTTATTTTGG + Intergenic
968219791 3:196928208-196928230 AGTCATTTCAGCATTTCTCTGGG - Intronic
969435104 4:7184805-7184827 TTGCATTTCAGCATGAATTTTGG - Intergenic
971429225 4:26546459-26546481 ATTTATTACTGCATCAATTTTGG + Intergenic
972342645 4:38165843-38165865 AATCAGTCCAGCATCTCTTTGGG + Intergenic
972892698 4:43578109-43578131 TTTCATTTCTGCTTTTATTTGGG - Intergenic
973221758 4:47734339-47734361 ATTCATTTCATCGGCTAATTAGG + Intronic
976954455 4:90878397-90878419 ATTCATTTGTACCTCTATTTGGG + Intronic
977504252 4:97881874-97881896 CTGATTTTCAGCATCTATTTAGG + Intronic
977950433 4:102964705-102964727 ATGCTTTTCTGCATCTATTGAGG - Intronic
978014794 4:103729611-103729633 AATCATTACAGAATCTATTCTGG - Intergenic
978326872 4:107568084-107568106 ATACATTTCTGCATCTACTGTGG - Intergenic
979099208 4:116593913-116593935 ACACATTTCAGCATAAATTTGGG + Intergenic
979858192 4:125661098-125661120 TTTCATTTCAGCTTTTGTTTAGG - Intergenic
979979984 4:127242935-127242957 AATTATTTCAAAATCTATTTTGG - Intergenic
980792297 4:137635093-137635115 ATAAATTTCAGCTTCTTTTTTGG - Intergenic
981204592 4:142024760-142024782 ATGTACTTCACCATCTATTTTGG - Exonic
982448877 4:155528060-155528082 ATTTATGTCTGCATTTATTTAGG - Intergenic
982593063 4:157340995-157341017 ATTCATGTCATAAACTATTTGGG + Intronic
983338321 4:166424241-166424263 ATTAGTTTCAGTACCTATTTTGG + Intergenic
983708115 4:170683061-170683083 ATTCATTTCAGTCTCTCTCTAGG - Intergenic
983992039 4:174131078-174131100 ATTTTTTTCAACATCTTTTTTGG + Intergenic
984754615 4:183313736-183313758 ATTCTTTCTAGCATCTCTTTTGG - Intronic
984816610 4:183843351-183843373 AATGATTTCATCTTCTATTTTGG - Intergenic
986896859 5:12381722-12381744 ATTCAATTTAGCACCGATTTTGG + Intergenic
987091859 5:14515148-14515170 ATTCAGTTCAGCAAATATGTGGG - Intronic
989086518 5:37682422-37682444 CTTCTTTTCAGCACCGATTTTGG + Intronic
989134699 5:38142193-38142215 AGTTATTTCAACATCAATTTGGG - Intergenic
990089797 5:52028933-52028955 ATTCATTTCAGCATCTATTTGGG - Intronic
990400399 5:55431858-55431880 TTTCATTTCTGAATTTATTTGGG - Intronic
990677150 5:58200142-58200164 ATTCATGTCTGCATATAATTTGG + Intergenic
990895073 5:60690521-60690543 AATTATTTCAACATCTTTTTAGG + Intronic
991010312 5:61875668-61875690 ATTCATTCAAGCAATTATTTAGG - Intergenic
992981064 5:82172856-82172878 ATTCATTTCAGCTACTATACTGG - Intronic
993946201 5:94119716-94119738 ATCAATTACAGCATCTATTGTGG - Intergenic
994003651 5:94811811-94811833 AGACATTTCAGGAACTATTTTGG - Intronic
994232546 5:97324565-97324587 ATTTCTTTCAGCATCTTTCTGGG + Intergenic
994902660 5:105795739-105795761 ATTCATTTCAGCAAATACATAGG - Intergenic
995298907 5:110555014-110555036 ATTCAGTTCAGCTCTTATTTTGG + Intronic
995438888 5:112167776-112167798 CTCCATTTCAGAATCTATCTAGG + Intronic
995476020 5:112549085-112549107 ATTCATTCCAACATTTATTCAGG + Intergenic
995488276 5:112661502-112661524 CTTCAGTTCAGCTTCGATTTTGG - Intergenic
998026687 5:138822839-138822861 CTTCATCTCAGTATATATTTAGG - Intronic
998772158 5:145558004-145558026 TTTCATTTCTTGATCTATTTAGG - Intronic
999106243 5:149073726-149073748 ATTCATGTTAGCATCTTTTGTGG - Intergenic
1001068872 5:168566388-168566410 TTTCATGTCAGAATCTCTTTCGG + Intronic
1001642593 5:173255275-173255297 ATTCATTTCAGCCTCATTTCAGG - Intergenic
1004714119 6:18200254-18200276 ATTGTTTTGAACATCTATTTTGG + Intronic
1005253730 6:23977107-23977129 TTTCCATGCAGCATCTATTTGGG + Intergenic
1006112753 6:31758594-31758616 ATCAATTTCAGGATCTATGTTGG - Exonic
1006321044 6:33319676-33319698 ATTGCTTTCAGCATCTATGCTGG + Exonic
1006427054 6:33971911-33971933 ATTCATTCTAGGAGCTATTTGGG - Intergenic
1007123389 6:39402180-39402202 CTTCAATTCAGCTTCTACTTGGG + Intronic
1007992840 6:46275209-46275231 TTTAAATTCAGCATCTGTTTGGG + Intronic
1008186969 6:48405516-48405538 AATCAGTTGAACATCTATTTTGG + Intergenic
1008296998 6:49790633-49790655 AGACATTTCAGCCTCTATGTGGG - Intergenic
1008473406 6:51909759-51909781 ATTGAAATAAGCATCTATTTAGG - Intronic
1008479944 6:51975771-51975793 ACTAAGTTCAGCATCTATATGGG + Intronic
1009448067 6:63766992-63767014 AGTCTTTTCTGCATCTATTGAGG - Intronic
1009819067 6:68776001-68776023 TGTCATTTCAGCATCCATTAAGG + Intronic
1010018355 6:71130564-71130586 ATTCATTTCAGACTGTATTCTGG - Intergenic
1010435789 6:75829126-75829148 ATGAAATTCAGCAACTATTTAGG - Intronic
1011002958 6:82611683-82611705 ATTCATTTTAGCAGCTACTGTGG - Intergenic
1011087848 6:83562458-83562480 TGTTATCTCAGCATCTATTTTGG + Intronic
1011385091 6:86787797-86787819 AATCATTTCACCATCCAGTTGGG + Intergenic
1011888448 6:92126963-92126985 TGTCATTTCTGCATCTGTTTGGG - Intergenic
1012122769 6:95387866-95387888 ATTCTATTCAGCAGCTACTTTGG - Intergenic
1012169440 6:96000811-96000833 CTTCAGTTCAGCTTCAATTTTGG - Intergenic
1012251077 6:96981549-96981571 CTTCAGTTCAGCATTGATTTTGG + Intronic
1012361233 6:98383202-98383224 AGTCATTTCAGCTTCTCTTATGG - Intergenic
1014668860 6:124273600-124273622 ATTCATCTCATCATTGATTTGGG + Intronic
1015227742 6:130877249-130877271 TTTCCTTTCAGCATCTAGTCTGG - Intronic
1015250193 6:131119301-131119323 AGTCAATTCATCATTTATTTTGG + Intergenic
1015321396 6:131879667-131879689 ATTGATTTCAGAATCTTTATAGG + Intronic
1016003357 6:139065311-139065333 CTTCATAGCAACATCTATTTGGG + Intergenic
1016297249 6:142586614-142586636 ATTTATATCAGAATGTATTTGGG + Intergenic
1016696883 6:147006555-147006577 ATTCAATTCAGCTTTGATTTTGG - Intergenic
1016836805 6:148485693-148485715 ATTCTTTTCTGCATGTATGTGGG - Intronic
1017230864 6:152072195-152072217 CTTCATTTTAGTATCTATATAGG + Intronic
1020664494 7:11023406-11023428 ATTAAGTTCACCATCTATTAAGG - Intronic
1020919802 7:14249075-14249097 TGTTTTTTCAGCATCTATTTAGG + Intronic
1021105251 7:16631145-16631167 ATACATTTTAGCATCTGTTGTGG + Intronic
1021150540 7:17145474-17145496 CTTCCTTACAGCATCTTTTTAGG - Intergenic
1021415629 7:20380976-20380998 ATTCATTTCGGTATGTGTTTGGG + Intronic
1022641461 7:32188861-32188883 ATTTTATTCATCATCTATTTGGG + Intronic
1022820969 7:33960641-33960663 TTTCCTTTCAAAATCTATTTTGG - Intronic
1023153611 7:37225697-37225719 ATTCCTTAGAGAATCTATTTTGG - Intronic
1023462166 7:40410524-40410546 TTTTATTTTAGCAGCTATTTTGG + Intronic
1024035066 7:45500948-45500970 TTTCATTACAGTATCTACTTTGG + Intergenic
1024681535 7:51694500-51694522 CTTGTTTTCAGCATCTATATGGG + Intergenic
1026287791 7:68978558-68978580 TTTAATTTCAGCTTCTATTTTGG + Intergenic
1026589951 7:71685744-71685766 ATCCAAGTGAGCATCTATTTAGG + Intronic
1026634028 7:72065559-72065581 ATTCATTACAGTATGTATTCTGG + Intronic
1027610983 7:80360372-80360394 TTACATTTCAACATCAATTTGGG - Intergenic
1027902889 7:84140770-84140792 TTTCATTTCAGCCTCTATTCTGG - Intronic
1028083944 7:86614165-86614187 ATTAATTTCAACATGAATTTTGG - Intergenic
1029854701 7:103503811-103503833 ATTAATGTCAACATCAATTTTGG - Intronic
1030371302 7:108702254-108702276 TTTCATTTCAGCAGATAATTGGG + Intergenic
1030404486 7:109093828-109093850 CTTAATTTCAGCATTAATTTAGG - Intergenic
1030450473 7:109703649-109703671 ATTCATTTCTACATTTAATTTGG - Intergenic
1030471772 7:109973300-109973322 TTTCATTTCTGACTCTATTTCGG + Intergenic
1032812252 7:135432047-135432069 ATTCTTTTTAGAATTTATTTTGG - Intronic
1032835274 7:135666663-135666685 ATCCATTTCCTCATTTATTTAGG + Intronic
1033052477 7:138018655-138018677 ATACATATCAGCATTTAGTTAGG - Intronic
1034132095 7:148728516-148728538 TTTCCTTTCATCATCTACTTGGG - Intronic
1034692678 7:153026670-153026692 GTTCCTTTCTGCATCTTTTTAGG + Intergenic
1035470510 7:159106223-159106245 TTTTATTTCAGCATCTTCTTTGG - Intronic
1037577367 8:20220328-20220350 ATTCTCTTCAGCATTTCTTTGGG - Exonic
1037862425 8:22415310-22415332 ACTCAATTCAGCAGCTATTTAGG - Intronic
1038306728 8:26410353-26410375 CTTCCTTTCAGCATCTATATTGG + Exonic
1040016415 8:42703916-42703938 AATGACTTCAGCTTCTATTTTGG + Intronic
1040497338 8:47977904-47977926 ATTCCTTCCATCATTTATTTAGG - Exonic
1040631786 8:49222236-49222258 ATTTTTTTCTGCCTCTATTTGGG + Intergenic
1040706922 8:50139542-50139564 AGTTATTTTAGCATATATTTGGG - Intronic
1041021079 8:53639372-53639394 ATTTATTACAGCCTCAATTTAGG + Intergenic
1041277355 8:56176389-56176411 CTTCATTTCAACTGCTATTTGGG + Intronic
1041565989 8:59279740-59279762 AATCATTTCAGGTTATATTTTGG - Intergenic
1041661540 8:60406139-60406161 ATGCACTTCAGAATCTCTTTGGG - Intergenic
1041964603 8:63660716-63660738 ATTCAGTTCAACATGTATTGAGG + Intergenic
1042013413 8:64277369-64277391 ATTCATATCATCTTCTTTTTGGG - Intergenic
1042684912 8:71427422-71427444 CTTTATTTCTGCATATATTTTGG - Intronic
1043722523 8:83563721-83563743 ATTGAATGCAGCATATATTTGGG + Intergenic
1045105833 8:98891831-98891853 ACTCAAGTCATCATCTATTTAGG + Intronic
1045267933 8:100636181-100636203 ATTTATTTCAGTATATATTCTGG + Intronic
1045277200 8:100719093-100719115 ATTAATTTCAGGATCTATAAAGG + Intronic
1045897645 8:107238084-107238106 GATCATTTAAGTATCTATTTTGG - Intergenic
1046385347 8:113501795-113501817 ATTCTTTACAGCACCTATGTAGG - Intergenic
1046590679 8:116202459-116202481 ATTCAATTCAACAAGTATTTTGG + Intergenic
1046660304 8:116941355-116941377 CTTCAGCTCAGCATTTATTTAGG + Intronic
1047710684 8:127549104-127549126 AATCATTTCAGGACCTCTTTTGG - Intergenic
1048928573 8:139292415-139292437 ATCCATTTCTGCAGCTATGTGGG + Intergenic
1051418371 9:16867612-16867634 CTTCAAGTCATCATCTATTTTGG + Intronic
1051855996 9:21566022-21566044 ATTCATTTCTGCATTTATCGAGG - Intergenic
1052074864 9:24128917-24128939 CTTCATTTCAGCTTTGATTTTGG + Intergenic
1054822923 9:69541913-69541935 TTTCAATTCAGCATGTGTTTGGG + Intronic
1055205520 9:73725085-73725107 ATTATTTTCAGTATGTATTTTGG + Intergenic
1055604652 9:77956250-77956272 ATACATTTCGGCTTCAATTTTGG - Intronic
1055666565 9:78558713-78558735 ATTTATTTATGCATTTATTTTGG + Intergenic
1056239507 9:84630235-84630257 ATTATTTGCATCATCTATTTTGG - Intergenic
1056608098 9:88103957-88103979 ATCCATTTCAGTAGATATTTGGG + Intergenic
1057564129 9:96153337-96153359 ATTAGTTTCAGCAGCTGTTTTGG - Intergenic
1058172781 9:101702941-101702963 ATTGAATTCAGGATATATTTTGG - Intronic
1060502145 9:124167182-124167204 ATAAAATTCAGCATCTATTTAGG - Intergenic
1187029871 X:15475019-15475041 ATTAAATTCAACATCCATTTTGG - Intronic
1187323516 X:18264600-18264622 ATTCATTTTACTATGTATTTGGG + Intronic
1188137711 X:26510146-26510168 ATTCATTCAATCATTTATTTCGG + Intergenic
1189408997 X:40753305-40753327 TTTCCTTTCTGCATCTATTGAGG + Intergenic
1189706419 X:43763211-43763233 ATTCAATTCCTCATGTATTTAGG + Intergenic
1190651056 X:52569255-52569277 ATTCAGTTCAGCATGTATATAGG + Intergenic
1191228246 X:58069238-58069260 AGACATTTCCGCATCCATTTAGG - Intergenic
1192311314 X:70016853-70016875 ATTCAGTTCAGCTTTGATTTTGG - Intronic
1193090317 X:77486945-77486967 AGTCTTTTCTGCATCTATTGAGG - Intergenic
1193583965 X:83297928-83297950 ATTCAATTCAGCTTTGATTTTGG - Intergenic
1193803180 X:85962084-85962106 ATTTATATCATCATTTATTTAGG + Intronic
1193851360 X:86541651-86541673 ATTCATTTGAGATTATATTTAGG + Intronic
1193889092 X:87020883-87020905 ATTATTTTCAGCAACTATATTGG - Intergenic
1193906006 X:87244911-87244933 ATTAAATTCAGCATCTTATTTGG - Intergenic
1194412643 X:93576171-93576193 TTACATTTCAGCATAAATTTTGG - Intergenic
1194479564 X:94403872-94403894 ATTCTCTTCTGCATCTCTTTAGG - Intergenic
1194525725 X:94975285-94975307 CTTCAGTTCAGCTTCGATTTTGG + Intergenic
1195544166 X:106096785-106096807 CTTCATTTCAGCTTTGATTTTGG + Intergenic
1196140495 X:112256658-112256680 TTACATTTCTCCATCTATTTAGG + Intergenic
1196459677 X:115917447-115917469 ATTCAGTTCAGCATGTAAATGGG + Intergenic
1196502091 X:116396595-116396617 ATTTTTTTCAGCTTTTATTTTGG + Intergenic
1197094597 X:122578318-122578340 AGTCTTTTCTGCATCTATTGAGG - Intergenic
1197155315 X:123263989-123264011 ATTCATCTAAGCCTTTATTTAGG - Intronic
1198817451 X:140607657-140607679 GTTCATCTCTGCATTTATTTAGG + Intergenic
1199153300 X:144516118-144516140 ATTCATTTCTGAATCTATAGAGG + Intergenic
1199339200 X:146656632-146656654 ATTCATTTCAACATGTATGTAGG - Intergenic
1201185510 Y:11398445-11398467 ATGCTTTTCTGCATCTATTGAGG - Intergenic
1201697745 Y:16844782-16844804 TTTCATTTCAACATGTTTTTGGG - Intergenic
1202152080 Y:21852598-21852620 ATTCATTTCTGCCTTTCTTTAGG + Intergenic