ID: 990090053

View in Genome Browser
Species Human (GRCh38)
Location 5:52032933-52032955
Sequence ATCTAGTTCCTCAAGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990090053 Original CRISPR ATCTAGTTCCTCAAGTGAGA GGG Intronic
909749401 1:79140078-79140100 ATCTTGTTCCTGAAATCAGAGGG + Intergenic
910010496 1:82455363-82455385 ATCTTGTTCCTCCAGAGAGGTGG + Intergenic
919808391 1:201394442-201394464 CTCTACTTCCTCAGGGGAGATGG + Intronic
920797889 1:209158285-209158307 CTCTAGTTCCTAAAGTCAAAGGG + Intergenic
921627222 1:217390121-217390143 TTCCAGTTCCTCAATTCAGAAGG + Intergenic
924067702 1:240242537-240242559 ATGTTGTTCCTCAACTGAGTAGG - Intronic
1063775222 10:9255775-9255797 ACCTAGTTCCCCCAATGAGAAGG - Intergenic
1064399443 10:15009168-15009190 ATCTTTTTCTTCAAGAGAGAAGG - Intergenic
1068246037 10:54370115-54370137 ATATACTTCCTCAAGTGCCATGG + Intronic
1068832026 10:61506864-61506886 ATGTAGTTCCTCAAGTCTCAAGG - Intergenic
1070718694 10:78741358-78741380 CTCTAGATCCTCAAGGGAAAGGG - Intergenic
1076548051 10:131259376-131259398 TTTTAGTTCTTCATGTGAGATGG - Intronic
1078228544 11:9416526-9416548 ATCTATTTTCACAAGTGAGACGG - Intronic
1079393227 11:20040176-20040198 ATCTAGATCCGCAAGGGATATGG + Intronic
1079870390 11:25791956-25791978 AGGAATTTCCTCAAGTGAGAGGG - Intergenic
1080045685 11:27805341-27805363 ATGTAGTTACACAAGGGAGAAGG + Intergenic
1084845189 11:71893113-71893135 ATCTTTTTCTTCAAGAGAGAAGG + Intronic
1090528429 11:127562733-127562755 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1091994240 12:4980595-4980617 TTCTTATTCCTCAAATGAGAGGG + Intergenic
1094110456 12:26856372-26856394 ATGTAGGTGCACAAGTGAGAAGG + Intergenic
1099621543 12:85008077-85008099 ATCTATTTCCTCTAGTAAGGAGG + Intergenic
1102069727 12:110008063-110008085 ATCTTGTTCCTCATCTTAGAGGG + Intronic
1103295244 12:119880846-119880868 ATCAAGCTCCCCAAGTGATATGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1107652681 13:42560370-42560392 ATCTAGCTAATCTAGTGAGAAGG + Intergenic
1108523826 13:51268431-51268453 ATCCATTTCCTCTAGTGAAAAGG - Intronic
1109189338 13:59306748-59306770 ATCCAGGTCTGCAAGTGAGAGGG + Intergenic
1110225567 13:73116224-73116246 ATCTAGTTCCCCACATCAGAGGG - Intergenic
1111147756 13:84206600-84206622 ATGGAGTTCCTGAAATGAGACGG + Intergenic
1111374573 13:87362293-87362315 ATCTAATTCCTCCATTGAGTGGG + Intergenic
1112917270 13:104567024-104567046 GTCTAGTCCCTGAAGTGAGAGGG + Intergenic
1115113884 14:29856643-29856665 ATCTAAATACTCAAGAGAGAAGG + Intronic
1115971200 14:38946587-38946609 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1121825318 14:97005747-97005769 ATCCAGTTCCTCATTTCAGATGG + Intergenic
1122203346 14:100135955-100135977 ACCTAACTCCTCAGGTGAGAGGG + Exonic
1124013083 15:25854405-25854427 TTCTAGTTCATCAATAGAGAAGG + Intronic
1127695081 15:61437853-61437875 ATCTAGTCCCTCAAGTCACAGGG - Intergenic
1130936204 15:88472870-88472892 AGGTGGTTCCTCAAGTGAGGAGG - Intronic
1136081252 16:27853945-27853967 ATCTAGTTACCCAAATGACAAGG - Intronic
1140912166 16:79464115-79464137 ACCTTGTTCCTCAAGGGAGAAGG - Intergenic
1147977508 17:44256216-44256238 ATCTTCTTCCTCAATTGACATGG + Intronic
1153733295 18:8037521-8037543 ATTTAGTACCTCAAGAGAAATGG - Intronic
1153970159 18:10218797-10218819 TTCTAGTTCCTCTAGCAAGAAGG - Intergenic
1156723994 18:40105471-40105493 ATGTAGTTCCTTAAGTGAAAGGG + Intergenic
1157083806 18:44556301-44556323 ATCCAGATCCTCAAGATAGAGGG - Intergenic
1157349183 18:46869840-46869862 ATCTATTTCCTCCTGGGAGATGG - Intronic
926860126 2:17300714-17300736 AAATAGTCCCTGAAGTGAGAAGG - Intergenic
928711407 2:34010654-34010676 CTCCATTTCCTCAAGTCAGATGG + Intergenic
930165637 2:48201232-48201254 GTCTAGTTGCTCAATTAAGATGG - Intergenic
930243291 2:48957967-48957989 ATCTAGTTCAAAAAGTGAGACGG - Intergenic
930307538 2:49694271-49694293 GTCTAGTTCCTGGAATGAGATGG + Intergenic
932551599 2:72775410-72775432 ATGGAATTTCTCAAGTGAGAAGG - Intronic
934233766 2:90211220-90211242 ATCTTGTTACTGAAGTGCGAGGG + Intergenic
935325153 2:101929089-101929111 ATCGCCTTCCTCAAGTGAAATGG + Intergenic
937781522 2:125843995-125844017 ATTCAGTTCCTCATGGGAGAGGG + Intergenic
938401915 2:131000362-131000384 ATCTATTTTCATAAGTGAGATGG + Intronic
938762140 2:134435599-134435621 ATCTAGTCCCTGGAGTGTGAGGG - Intronic
941273913 2:163466232-163466254 ATCCAGTGCCTCTTGTGAGAAGG - Intergenic
941771560 2:169350841-169350863 ATCTTGTTCCTGAAGAAAGAAGG - Intronic
942473231 2:176284968-176284990 ATCAAGTTCCTCAAGTGTACAGG + Intronic
943183204 2:184571299-184571321 ATCTAATTCCACAAGTTATATGG - Intergenic
943641869 2:190368386-190368408 ATTTGGTCCCTCAAGTTAGAAGG - Intronic
943902450 2:193457491-193457513 ATCTAGAACCTCAAGGAAGACGG + Intergenic
945911359 2:215653459-215653481 ATCCATTTCCTCAAGTGTAATGG - Intergenic
947591175 2:231386893-231386915 ATCCAGTTCCTCAAGGGTGTGGG + Intergenic
947969527 2:234310800-234310822 ATCGAGTTCCTCAAGGCAGGTGG - Intergenic
1172727719 20:37059164-37059186 ATCTATTTACTCAAATGATATGG + Intronic
1173808947 20:45944684-45944706 ATCTTATTCCTCAAGTGTCAAGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1176266952 20:64214653-64214675 TTCTAGTTCCTCACGGGAGTGGG - Intronic
1178577643 21:33808761-33808783 AACTAGCTCCTAAATTGAGACGG + Intronic
1183290357 22:36998349-36998371 ACCTGGTTCCTCAGGTGACAGGG + Intronic
949803606 3:7930596-7930618 ATCTGGAGCCTCAACTGAGAAGG - Intergenic
949989239 3:9564057-9564079 ATCCAGTTGCTCACGTGATAGGG + Intergenic
951079208 3:18431237-18431259 AAGGAGGTCCTCAAGTGAGAAGG - Intronic
951542346 3:23794108-23794130 ATAGAGTTCCTCAAAAGAGAAGG + Intergenic
954602601 3:51881292-51881314 ATCTAGTACCTCCAGTCAGATGG + Intergenic
956223830 3:66933806-66933828 ATCAAGTTCCTGAAGTAATAGGG + Intergenic
962098246 3:132314835-132314857 TTTTAGCTCTTCAAGTGAGAAGG - Intergenic
963087298 3:141450052-141450074 ACCCAGTTCCTCAAGCAAGATGG + Intergenic
963441273 3:145343453-145343475 ATATAGTTTGTCAACTGAGAAGG + Intergenic
963652991 3:148007968-148007990 ATCTAGTTCCCCAAATCATACGG + Intergenic
964668914 3:159203918-159203940 GGCAGGTTCCTCAAGTGAGAGGG + Intronic
964760117 3:160127472-160127494 ATGAAGGTCCTCAAGAGAGAAGG + Intergenic
969730023 4:8949294-8949316 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
969789627 4:9483408-9483430 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
977647442 4:99429568-99429590 TTCTATTTCCTCAATGGAGAAGG + Exonic
979906278 4:126297926-126297948 TTGTATTTCCTAAAGTGAGATGG - Intergenic
981983909 4:150830494-150830516 ATATAGTGCCTCAGGTGGGATGG - Intronic
986313925 5:6573516-6573538 ATCAAGATCTTCAAGAGAGAAGG - Intergenic
986379148 5:7165655-7165677 ATCCAGATCTTCAAGTGAGGCGG - Intergenic
986865554 5:11982199-11982221 ATCTCCTTCCTCAAGTGACCTGG + Intergenic
988051680 5:26039285-26039307 TTTTTGTTCCTCAACTGAGAGGG + Intergenic
990090053 5:52032933-52032955 ATCTAGTTCCTCAAGTGAGAGGG + Intronic
990685702 5:58298338-58298360 ATCAAGTTTCTTCAGTGAGATGG - Intergenic
992577849 5:78137466-78137488 CTCTACTTCCTCAAGCCAGAAGG + Intronic
993387313 5:87275472-87275494 ATCTAGTGCCTCAACTGGGATGG + Intronic
993858637 5:93106519-93106541 ATTTAGTTCCTTCAGCGAGAGGG - Intergenic
996140163 5:119897317-119897339 ATGAAGGTCCTGAAGTGAGAGGG + Intergenic
1001999083 5:176186882-176186904 ATGCTGTTCCTCCAGTGAGATGG - Intergenic
1005531388 6:26710158-26710180 GTCTAGTCCCTCAAGCCAGAAGG + Intergenic
1009782715 6:68291612-68291634 ATCTGGTTCTTCAAGTCAAAGGG - Intergenic
1010008447 6:71022785-71022807 ACTTAGCTCCTCAAGTGTGAAGG - Intergenic
1010239030 6:73599681-73599703 TTCTAATTCCTTAAGTGACACGG - Intronic
1017030257 6:150214636-150214658 AACTAGATCATCAATTGAGAAGG - Intronic
1019518329 7:1449274-1449296 GTCCAGTTCCTCAAGTGTGCCGG - Intronic
1021170890 7:17396877-17396899 ACCTATTTCCTCCAGTGAGGAGG - Intergenic
1021751885 7:23809065-23809087 ATATTGTTCCTCAAGTGGCAAGG + Intronic
1022913387 7:34921540-34921562 ATCAATTTCCTCAAGCCAGAAGG - Intergenic
1023056886 7:36298059-36298081 AACTAGTGCCCCAAGAGAGAGGG - Intronic
1023082129 7:36535737-36535759 ATCTGTGTCCTCAAATGAGAGGG - Intronic
1027192538 7:76005396-76005418 ATCCAGTTCCTGAAGTGTGGAGG + Exonic
1028343195 7:89747682-89747704 ATTTTGTTCCTCAAGTGCCAAGG - Intergenic
1031172658 7:118311004-118311026 AAATTGTTCCTCAAGTAAGAAGG - Intergenic
1032903255 7:136335203-136335225 ATCTGTTTCCTGAATTGAGAAGG - Intergenic
1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG + Intronic
1035495770 7:159324629-159324651 ATATAGTTCCACAGGTGAGAAGG - Intergenic
1038709697 8:29931848-29931870 TTCTAGTTCCTTAAGTTAGACGG - Intergenic
1045540702 8:103081530-103081552 AGATAGTTCCTCAAATGAGAGGG - Intergenic
1050728068 9:8675247-8675269 CTCTAGTTCCTCAAGTGTGAGGG + Intronic
1051015020 9:12463488-12463510 TTCCAGTTCCTCAAGTGGGTGGG + Intergenic
1051593610 9:18801082-18801104 ACCTACTTCCTCAAGTGCTAAGG + Intronic
1054872404 9:70060197-70060219 ATCTGGTGACACAAGTGAGAGGG - Intronic
1055825324 9:80317038-80317060 ATCTTGTACCTCAATTGAAAGGG + Intergenic
1059334053 9:113557556-113557578 GGCTAGTTCCTCAAGTGAATGGG + Intronic
1059826700 9:118037927-118037949 ATCTACTTCCTCAACTAAAATGG - Intergenic
1060316900 9:122519929-122519951 ATCCAGTGCCTCCAGTGACAAGG + Exonic
1061505154 9:131027564-131027586 ATCCAGTTCCTCAACTGCGCTGG - Intronic
1189152486 X:38722795-38722817 ATCTAGCTCATCCAGTAAGAGGG + Intergenic
1193094778 X:77535402-77535424 ATCTAGTTCTTTAAGTGTTAAGG - Intronic
1200815730 Y:7530254-7530276 ATCTTGTTCCTCTAGTGTGATGG - Intergenic
1201254653 Y:12095004-12095026 ATTTAATTCCACAAGTTAGAGGG - Intergenic