ID: 990092106

View in Genome Browser
Species Human (GRCh38)
Location 5:52064412-52064434
Sequence CTGGGGTATGTCTGTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990092094_990092106 9 Left 990092094 5:52064380-52064402 CCGAATTTTCCCTCTGGATCTCA 0: 1
1: 0
2: 2
3: 32
4: 300
Right 990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 202
990092092_990092106 15 Left 990092092 5:52064374-52064396 CCTAAGCCGAATTTTCCCTCTGG 0: 1
1: 0
2: 2
3: 13
4: 140
Right 990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 202
990092099_990092106 -1 Left 990092099 5:52064390-52064412 CCTCTGGATCTCAGAAGGGGCCC 0: 1
1: 0
2: 1
3: 22
4: 188
Right 990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 202
990092098_990092106 0 Left 990092098 5:52064389-52064411 CCCTCTGGATCTCAGAAGGGGCC 0: 1
1: 0
2: 0
3: 21
4: 181
Right 990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990092106 Original CRISPR CTGGGGTATGTCTGTTTTGT GGG Intronic
905619226 1:39427693-39427715 CTAGAGGATGTGTGTTTTGTGGG + Intronic
906077527 1:43063032-43063054 CTGGGGTCTGTGTGTGTTCTGGG + Intergenic
906209187 1:44002774-44002796 CTGGGTTATGTGTGTATTGCAGG - Intronic
907833848 1:58090739-58090761 CTGGGCTGTGTCTGATTTGTTGG - Intronic
908265727 1:62377480-62377502 CTGGGGTATGTCTGCTTCCTAGG + Intergenic
908711446 1:67019996-67020018 CTGAGGTCTGGCTGTTTTGTAGG - Intronic
909165793 1:72222252-72222274 CTGGGGTAGACCTGTTTTTTAGG - Intronic
914677421 1:149915741-149915763 CTGGAGAATGTCTTTTTTGGGGG - Intronic
915543148 1:156581571-156581593 CAGGGGTATCCCTGGTTTGTGGG - Exonic
918864878 1:189882307-189882329 CTCGGGTATGTCTGTATTAGTGG + Intergenic
920923534 1:210319575-210319597 TTGGGGTTTGTCACTTTTGTTGG + Intergenic
921407139 1:214792566-214792588 CTTGGGTTTGGCTTTTTTGTTGG + Intergenic
921938711 1:220817933-220817955 CTGAGGTAATTCTGCTTTGTAGG - Exonic
923118925 1:230971812-230971834 GTGGGGAAGGCCTGTTTTGTTGG - Intronic
923279045 1:232424399-232424421 CTGTGGTACGTGTGTTATGTTGG - Intronic
924046040 1:240031801-240031823 CTGGTGCATGTATATTTTGTAGG - Intronic
924743717 1:246813472-246813494 CAGGGGTGGGGCTGTTTTGTAGG - Intergenic
1063083446 10:2790590-2790612 CTCTGGCTTGTCTGTTTTGTGGG - Intergenic
1063363665 10:5476877-5476899 ATGGGGTGGGGCTGTTTTGTAGG - Intergenic
1063573991 10:7244680-7244702 CTGGGTTATGTCTGTTGAATTGG - Intronic
1065200529 10:23308822-23308844 CTGGGGGCTGTCTTTGTTGTAGG - Intronic
1065392840 10:25202107-25202129 CTGGGCTTTTTCTGTTTGGTAGG + Intronic
1067726490 10:48774853-48774875 GGGGGCTATGTCTGCTTTGTGGG - Intronic
1067853785 10:49772866-49772888 ATGGGGTGGGTCTGTTTTATAGG + Intergenic
1068390409 10:56388616-56388638 CTGTGGTTTGTGTGTTTTTTTGG + Intergenic
1069554558 10:69389338-69389360 CTGGGGTTTCCCCGTTTTGTGGG + Intronic
1072878929 10:99204222-99204244 CTGGGGTGGGTCTGTTGTTTGGG - Intronic
1074941801 10:118243716-118243738 CTGGTGTGTGTGTGTTTGGTGGG - Intergenic
1076018904 10:127053885-127053907 TTGGGGGATGGCTATTTTGTGGG + Intronic
1076901204 10:133338858-133338880 CTGGTGTGTGTGTGTTTGGTAGG - Intronic
1077889182 11:6406362-6406384 CTGGGCTATGTTAGTTATGTGGG - Intronic
1078481842 11:11683485-11683507 CTTGGGTATGTCTTTATTGGTGG + Intergenic
1080886287 11:36371098-36371120 ATGGGGTATTTCTGGTATGTTGG - Intronic
1081036165 11:38148993-38149015 CTAGGATATGTCTGTTCTATAGG - Intergenic
1082768285 11:57185646-57185668 CTTGGGTAAGTCTTTTTTTTTGG - Intronic
1084141136 11:67230329-67230351 CTGGTCTATATGTGTTTTGTTGG - Intronic
1085933994 11:81122180-81122202 CTGGATTATGTATGTTTTATAGG + Intergenic
1087479456 11:98680833-98680855 CTGGGGCATGTCTGTTCTGTAGG - Intergenic
1087907696 11:103718221-103718243 CTGGGCTATTTCTGGTTGGTAGG + Intergenic
1088506086 11:110528753-110528775 CTGGGCTATTTCTGGTTGGTAGG + Intergenic
1090146801 11:124333215-124333237 CTGGGAAATGTATGTTTTGGAGG + Intergenic
1091280732 11:134380192-134380214 CAGAGGTATGTCTGATTTGGGGG + Intronic
1093002393 12:14011939-14011961 CTGAGATATGTCTGGTTTGCAGG - Intergenic
1093503846 12:19841817-19841839 TTGGGGTATGTGTGTGTTGGGGG + Intergenic
1094074647 12:26459389-26459411 CTGGCGTGTGTCTGCTTTGCAGG + Intronic
1097173490 12:57129652-57129674 CTGGGGTAGGGCTGTGTTGGGGG + Intronic
1097983169 12:65754994-65755016 CTGGGTTATGTTTATTTTGGGGG + Intergenic
1098236100 12:68419973-68419995 TTGGGGTTTCTTTGTTTTGTTGG - Intergenic
1099126004 12:78759097-78759119 CTGGAGTATGTGTTTTTTGGGGG + Intergenic
1099373415 12:81866116-81866138 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1099683993 12:85862835-85862857 CTGGGGTTTTTTTGTTTGGTAGG + Intergenic
1101648853 12:106656539-106656561 GTGGGGGATGTCTGTTCCGTAGG - Intronic
1102209905 12:111118844-111118866 CTGGGGTGTGTCTGGCTTTTGGG + Intronic
1102980319 12:117236053-117236075 ATGGGGTTTGTTTGTTTTTTGGG - Intronic
1103086459 12:118064805-118064827 TTGGGGAAGGTCTGTTTTCTTGG - Exonic
1103086526 12:118065511-118065533 TTGGGGAAGGTCTGTTTTCTTGG - Exonic
1103740116 12:123085360-123085382 TTGAGGTTTGTCTGTGTTGTAGG - Intronic
1109628061 13:65004630-65004652 CTGGCATATATCTGTTTTTTTGG - Intergenic
1110250045 13:73371267-73371289 CTGGGGTTCCTCTGTTTTGTAGG - Intergenic
1110675823 13:78242760-78242782 ATAGGAAATGTCTGTTTTGTGGG - Intergenic
1117405356 14:55396850-55396872 CTGAGGTTTGTTTTTTTTGTGGG - Intronic
1118063245 14:62163593-62163615 CTGGGTTCTTTCTGATTTGTGGG + Intergenic
1118801722 14:69195880-69195902 CTGTGGTATATTTATTTTGTAGG + Intronic
1119231370 14:72982450-72982472 TTGGGTAATGTCTGTTTTGGGGG - Intronic
1122244026 14:100388654-100388676 CTGGGAAATGTCTCATTTGTTGG - Intronic
1124824954 15:33084440-33084462 CTGAGGTGTGGCAGTTTTGTGGG + Intronic
1125754073 15:42050503-42050525 CTGAGGTATGTCTGTGTTCCTGG - Exonic
1126206633 15:46053164-46053186 CTGGGGCACATCTGTTTTGCAGG - Intergenic
1126489983 15:49225990-49226012 ATGGGGCATGTCTGTTCTGCAGG - Intronic
1126614870 15:50567511-50567533 CTGTGGTAGGTTTGTTTTATGGG - Intronic
1126749119 15:51858474-51858496 CTGGTGTATACCTGTTTTATTGG - Intronic
1128212720 15:65913681-65913703 CTGGGGTATGTGTGTGTGGAGGG + Intronic
1128361459 15:66964686-66964708 CTGGGGTCTGTCTGCTCTGTGGG - Intergenic
1130555185 15:84917725-84917747 CTAGGGTATGTCTGTATCCTAGG + Intronic
1132832544 16:1935911-1935933 CTGGGGTTTGACTGGTTGGTTGG - Intergenic
1133732127 16:8586934-8586956 CTAGGGTATGTCTCCTTTGGTGG + Intronic
1134319319 16:13148457-13148479 GTGAGGTATATATGTTTTGTGGG - Intronic
1134408623 16:13984409-13984431 CAGAGGTTTGTCTGTTTTATTGG + Intergenic
1138542834 16:57698894-57698916 CTTGGGTGTGTTGGTTTTGTAGG - Exonic
1140154884 16:72413755-72413777 CTGGGGTTTTTTTGTTTGGTTGG - Intergenic
1142997178 17:3767623-3767645 GTGGGGTTTGTTTGTTTTTTAGG + Intronic
1144685271 17:17221957-17221979 CAGGAGTCTGTCCGTTTTGTCGG + Intronic
1144750141 17:17642769-17642791 CAGGGATTTGTCTGTTGTGTTGG + Intergenic
1146938475 17:36827055-36827077 CAGGGGTATTCCTGTTCTGTGGG - Intergenic
1149062563 17:52440272-52440294 CTGGGATTTTTCTGTTTGGTAGG - Intergenic
1149194422 17:54102486-54102508 CTGGGGCATGTCTGCTCTGCAGG + Intergenic
1149300323 17:55299409-55299431 CTGGAGAGTGTATGTTTTGTGGG - Intronic
1149916148 17:60611415-60611437 GTGGGGTTTTTTTGTTTTGTTGG + Intronic
1150207456 17:63419863-63419885 CTGGGGTATTTCGGTTTAGTTGG - Intronic
1151682205 17:75628159-75628181 CTGGGGTATGTGGGTGTAGTGGG - Intronic
1153152571 18:2111626-2111648 CTGGGGTAAGGCAGTTGTGTGGG - Intergenic
1154228925 18:12535971-12535993 TGGGGGTGTGTCTGTTTTTTTGG - Intronic
1155960988 18:31994751-31994773 CTGGGCTAAGTTTGTTCTGTAGG - Intergenic
1156650343 18:39218533-39218555 CTGGGGTGTGTTTGTTTGTTGGG - Intergenic
1156907365 18:42370013-42370035 CAGGGCTAATTCTGTTTTGTAGG + Intergenic
1157053569 18:44198448-44198470 CTGGGGCATGTCTGTCCTGCAGG + Intergenic
1159687584 18:71442312-71442334 CTGGGAAATGTATGTTGTGTTGG + Intergenic
1163393365 19:17044100-17044122 GTGGGGTCTGTCTGTTCAGTGGG + Intergenic
1164034625 19:21442855-21442877 TTGGTGTATGTTTGTTTTTTTGG + Intronic
1164383712 19:27755973-27755995 CTGTGATATGTCTGTTGAGTTGG + Intergenic
1164716496 19:30394463-30394485 CCTGGGTATGTGTGTGTTGTGGG - Intronic
1165112540 19:33510806-33510828 CTGGAGTATGACTGTGTGGTAGG - Intronic
1165183370 19:33993637-33993659 CTGGTGTGTGTGTGTTTTGTGGG - Intergenic
1167026173 19:46920335-46920357 CTGGGGCATGTCTCCTTTGTTGG - Exonic
1167033431 19:46978637-46978659 GTGGGGTATGTGTGTGTGGTGGG + Intronic
1167667440 19:50830998-50831020 CTGGAGTCTGTCTGTGCTGTTGG + Intronic
928383490 2:30842342-30842364 AAGAGGTATGTCTGTTTTATTGG - Intergenic
931308515 2:61056143-61056165 CTGGGGGCTCTCTGTTTTGTTGG + Intergenic
933052742 2:77620091-77620113 CTGGGGTTTTTCTGCTTGGTAGG - Intergenic
934079638 2:88456823-88456845 TTGGGATTTGTTTGTTTTGTGGG - Intergenic
935855736 2:107270775-107270797 CTGGGCCAGGTCTGATTTGTGGG + Intergenic
937110639 2:119364621-119364643 CTGGCTTATGTGTGTTTGGTGGG + Intronic
937639000 2:124190495-124190517 CTGGGGTAGCTCTGATTTTTGGG - Intronic
941080808 2:161058501-161058523 CTTTTGTATGTCTGTTTTCTTGG - Intergenic
942657257 2:178226602-178226624 TTGGTGTATGTCGGATTTGTAGG + Intronic
944354548 2:198770820-198770842 CTGGGGTATGTCATTTTTTGAGG - Intergenic
946668805 2:222080153-222080175 CAGGTGAATGTCTGTTTAGTTGG - Intergenic
1170028963 20:11924076-11924098 CTGAGGTTTATCTGTTTTGGGGG - Exonic
1173064860 20:39700613-39700635 CAGGGGCATCTCTGTTTTCTTGG - Intergenic
1175262543 20:57683907-57683929 CTGTGGGCTGTCTGTTTTGGGGG + Intronic
1175662763 20:60830663-60830685 CTGTGTTTTGTCTGTTTGGTTGG + Intergenic
1182006957 22:26968945-26968967 CTTGGGCATGCCTGTGTTGTGGG + Intergenic
1182234666 22:28865900-28865922 CTGTGGTATCCCTGTTTTGTAGG - Intergenic
1183825685 22:40384988-40385010 GTGGGGAATGTCTTTTTTGGGGG + Intronic
1184399651 22:44266496-44266518 CTGGTGTATGTGTGTGTTGGGGG + Intronic
951847789 3:27103314-27103336 CTGAGGTTTGTCTGTTTGCTTGG + Intergenic
953211603 3:40880146-40880168 CTGAGGTATGCCTGTATTGAAGG - Intergenic
954472252 3:50707891-50707913 GTGGGGTATGTGTGTTGTGGTGG + Intronic
954834950 3:53458130-53458152 CTGGGATATGTTTCTTTTGAGGG + Intergenic
956849119 3:73212220-73212242 CTTGGGTATGTCTTTTTCTTGGG - Intergenic
958858545 3:99417223-99417245 CTTGGGTATGACTGTTTTCCTGG - Intergenic
960143766 3:114176619-114176641 CTCGGGAATGACAGTTTTGTGGG - Intronic
962410579 3:135138192-135138214 ATGGGTTGTGTCTGTGTTGTGGG - Intronic
962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG + Intergenic
964364271 3:155932317-155932339 GTGGGGGTTGTTTGTTTTGTAGG - Intronic
965619048 3:170624027-170624049 TTGTGATATATCTGTTTTGTAGG - Intronic
965663329 3:171065215-171065237 CTAGGTTATGTTTGTTTTCTGGG + Intronic
969657844 4:8508382-8508404 ATGGGTTGTGTCTGTTGTGTGGG + Intergenic
970504639 4:16714985-16715007 CTGGGGTATATCTTTTTTTGGGG + Intronic
970570281 4:17374322-17374344 CTTGGGAATGTCTTTTTTTTGGG - Intergenic
970595044 4:17592362-17592384 CTGGGGTTTATCTATGTTGTTGG + Intronic
972423210 4:38909614-38909636 CTGGGGCATGCCTGGATTGTGGG - Intronic
975035741 4:69678328-69678350 CTGGGGTTTGTCGGTGTTGGGGG - Intergenic
975944159 4:79684485-79684507 TTTGGGTAAGTTTGTTTTGTTGG - Intergenic
978029945 4:103929033-103929055 CTGGGCTATTTCTGGTTGGTAGG - Intergenic
978287390 4:107095040-107095062 CTAGGGCATGTCTGTTCTGGAGG - Intronic
980504087 4:133692192-133692214 CTTGGGTATGGTTGTCTTGTAGG - Intergenic
980893369 4:138837959-138837981 CCTGGGTATGTTTTTTTTGTGGG + Intergenic
981078953 4:140619045-140619067 TTGGGGGGTGTTTGTTTTGTAGG - Intergenic
981656540 4:147118320-147118342 CTGGGGTATGGCTGTTTAGGAGG + Intergenic
987222927 5:15808961-15808983 CTGGGGTTTGGATGGTTTGTTGG - Intronic
988850018 5:35171725-35171747 ATGGGGTATGCCTGGGTTGTAGG + Intronic
990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG + Intronic
995782711 5:115795139-115795161 CTGGCACATGTCTTTTTTGTGGG - Intergenic
997600678 5:135136296-135136318 CTGGGGTAGGTCTGTTTTGGGGG + Intronic
998929624 5:147166751-147166773 CTGAGGTATGTGTGTTTGTTTGG - Intergenic
1001679926 5:173548959-173548981 GTGGGGTGTGTGTGTGTTGTGGG + Intergenic
1003006318 6:2385676-2385698 CTGGCTTACGTCTGTTTGGTCGG - Intergenic
1009438723 6:63650151-63650173 CTACAGTATGTCTGTTTTGTTGG - Intronic
1009497589 6:64370649-64370671 CTGGGTTATTTCTAGTTTGTAGG + Intronic
1010520927 6:76835755-76835777 CTGAAGTATGACTGTTTTCTTGG + Intergenic
1016143239 6:140639691-140639713 TTGGTGTATGTTTGTTTTGGGGG - Intergenic
1016270715 6:142286672-142286694 CAGGGTTAAGTCTGTTTTTTAGG + Intergenic
1017721437 6:157246053-157246075 CTGGGGTTTGTCTTTCTTGCGGG - Intergenic
1017939989 6:159043714-159043736 ATGCTGTATGTGTGTTTTGTGGG - Intronic
1018990571 6:168670629-168670651 CTGGGGGAAGTCTGTCATGTGGG + Intronic
1020456455 7:8379043-8379065 GAGGGGTTTGTCTGTTTTGCAGG - Intergenic
1021773901 7:24032713-24032735 CAGGGGTATGTTTGTTATTTAGG + Intergenic
1021853835 7:24834235-24834257 CTGGGGTAGTTCTGTTCTGTGGG - Intronic
1022831937 7:34076405-34076427 TTGGGGTGTGTATGTTTTGGCGG + Intronic
1026370713 7:69695967-69695989 TTGTGGTATTTTTGTTTTGTGGG + Intronic
1027783006 7:82543030-82543052 CTGGGTTTTGTTTGTTTTATTGG - Intergenic
1028288871 7:89040961-89040983 CTGGGGTAGGTCTGGTTATTGGG + Intronic
1029118513 7:98251118-98251140 CTGGGACTTGTTTGTTTTGTAGG + Intronic
1030493816 7:110272129-110272151 CTGGGATGTGGCTATTTTGTTGG + Intergenic
1030503496 7:110389014-110389036 CTAGGTTATGTCTATTTTTTAGG + Intergenic
1032768474 7:135023728-135023750 CTGGGGCATGTCTGTTCTTCAGG + Intronic
1033424711 7:141233591-141233613 CTGGGGTATGTGTTTTGTGAGGG + Intronic
1036038660 8:5048762-5048784 CTTGGTTAAGGCTGTTTTGTGGG - Intergenic
1037904801 8:22709811-22709833 CTGGGCCATGTGTGATTTGTGGG - Intergenic
1038145309 8:24889329-24889351 ATTGGGAATGTCTTTTTTGTGGG + Intergenic
1040056215 8:43059071-43059093 TTGGGGAATGTCTGTTTTCAGGG + Exonic
1042496593 8:69461637-69461659 CTGGAGTAGTTCTGTTTTCTTGG - Intergenic
1042705812 8:71664892-71664914 ATGGGGTGTGGCTGTTTTATAGG - Intergenic
1043073955 8:75672804-75672826 CTGAGATATGTCTGTATGGTAGG + Intergenic
1043761612 8:84075768-84075790 CTGGGGCATGTTTGTTATGCTGG - Intergenic
1044186128 8:89254069-89254091 CTGGGGTATGACTGTTCTGCAGG - Intergenic
1045189061 8:99865473-99865495 CTGGCGGAGGCCTGTTTTGTTGG - Intronic
1047357096 8:124132849-124132871 CTGGGGTTTTTCTGGTTGGTAGG - Intergenic
1049234832 8:141507304-141507326 CTAGGGTCTGTCTGTGTTGTGGG + Intergenic
1049955592 9:689792-689814 CTGGGTTATTTCTGTTATATTGG - Intronic
1050391598 9:5148935-5148957 CTGCAGCATGTCTGTTTTGCAGG - Intronic
1052504041 9:29329695-29329717 CTGGGGTATGATCGTATTGTTGG + Intergenic
1052650023 9:31290713-31290735 CTGGGGCATATCTGTTCTGCAGG + Intergenic
1053131459 9:35617980-35618002 CTGGGGGATGTGTGTTTGTTGGG - Intronic
1053165844 9:35842937-35842959 CTGGGGTTTCCCAGTTTTGTAGG + Intronic
1055106025 9:72513941-72513963 CTGGGGTGTATATGTTTTGGAGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057078556 9:92154636-92154658 CTGGGGTGTGTGTGGTGTGTGGG - Intergenic
1058246524 9:102632395-102632417 CTAGGGTACATCTGTTCTGTAGG - Intergenic
1058979788 9:110158427-110158449 CTTGTGTATGTCTTTTGTGTTGG + Intronic
1059232242 9:112731651-112731673 CTAGAATGTGTCTGTTTTGTGGG - Intergenic
1060081564 9:120652033-120652055 TTGGGGTATTTGTTTTTTGTTGG - Intronic
1060623469 9:125089083-125089105 TTGGGGAGTTTCTGTTTTGTAGG - Intronic
1060681144 9:125566224-125566246 CTGGACTGTGTCTGTTTTATGGG - Intronic
1061523370 9:131136512-131136534 CTGGAGTATGCCTGATGTGTAGG + Intronic
1062067191 9:134534961-134534983 CTGAGCTGTGTCCGTTTTGTTGG - Intergenic
1186230396 X:7447426-7447448 TTGGAGTAGGTCAGTTTTGTGGG - Intergenic
1186247663 X:7631589-7631611 CTGGGGCATGTCTGTTATGCAGG + Intergenic
1187380338 X:18795935-18795957 CTGGGTTTTGTTTGTTTGGTTGG + Intronic
1189607540 X:42695727-42695749 CTGGGGTATGACTGGTCTTTTGG + Intergenic
1189678594 X:43490191-43490213 CTGGGGTTTTTCTGATTGGTAGG - Intergenic
1190748716 X:53342726-53342748 TTGGGGTTTTTGTGTTTTGTGGG - Intergenic
1191176894 X:57513591-57513613 CTGGGGTTTTTCTGGTTAGTAGG + Intergenic
1192300311 X:69894232-69894254 CTGGGCTATTTCTGTTCCGTTGG + Intronic
1193689412 X:84622490-84622512 CTGGGGCACATCTGTTTTGCAGG - Intergenic
1194156279 X:90393376-90393398 ATGGGGAATGTCTGTTTTTTAGG - Intergenic
1199461847 X:148093849-148093871 CTGGGGCATGTGTGTCTTGCAGG - Intergenic
1200502625 Y:3970354-3970376 ATGGGGAATGTCTGTTTTTTAGG - Intergenic
1200964999 Y:9027670-9027692 CTGGGAGATGCCTGTTTTTTTGG + Intergenic
1200981566 Y:9267386-9267408 CTTGGAAATGTCTGTTTTTTTGG + Intergenic
1201349489 Y:13023875-13023897 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1201446753 Y:14065117-14065139 CTTGGGTATTTCTTTTTTTTTGG - Intergenic
1202097220 Y:21264242-21264264 CTTGGGCATGTCTGTTTTGCAGG - Intergenic