ID: 990095393

View in Genome Browser
Species Human (GRCh38)
Location 5:52105444-52105466
Sequence TTGGATAAATAGAACAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990095389_990095393 30 Left 990095389 5:52105391-52105413 CCAACTTTACACAGTGGCTAGGG No data
Right 990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990095393 Original CRISPR TTGGATAAATAGAACAAACA CGG Intergenic
No off target data available for this crispr