ID: 990104312

View in Genome Browser
Species Human (GRCh38)
Location 5:52237877-52237899
Sequence CAAACCATTCCCTTGTAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990104309_990104312 25 Left 990104309 5:52237829-52237851 CCAAAGAGAGGGAGTGACATTTC No data
Right 990104312 5:52237877-52237899 CAAACCATTCCCTTGTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990104312 Original CRISPR CAAACCATTCCCTTGTAGGT CGG Intergenic
No off target data available for this crispr