ID: 990108138

View in Genome Browser
Species Human (GRCh38)
Location 5:52289818-52289840
Sequence CAGATGGTTCAACTTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990108132_990108138 20 Left 990108132 5:52289775-52289797 CCAAGACATGCTAACGAAGAGGA No data
Right 990108138 5:52289818-52289840 CAGATGGTTCAACTTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990108138 Original CRISPR CAGATGGTTCAACTTGGCAT GGG Intergenic
No off target data available for this crispr