ID: 990115382

View in Genome Browser
Species Human (GRCh38)
Location 5:52383492-52383514
Sequence CACAAACATCACATTTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990115382_990115386 -8 Left 990115382 5:52383492-52383514 CCCCCTTAAATGTGATGTTTGTG No data
Right 990115386 5:52383507-52383529 TGTTTGTGTTAATGATTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990115382 Original CRISPR CACAAACATCACATTTAAGG GGG (reversed) Intergenic
No off target data available for this crispr