ID: 990115564

View in Genome Browser
Species Human (GRCh38)
Location 5:52386019-52386041
Sequence CTGGAAAGAAGGAGAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990115559_990115564 3 Left 990115559 5:52385993-52386015 CCTGAAGTTGTAATCCATTGGCA No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115552_990115564 27 Left 990115552 5:52385969-52385991 CCGGTCTTCTTGTCCCCCAGCTA No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115555_990115564 12 Left 990115555 5:52385984-52386006 CCCAGCTACCCTGAAGTTGTAAT No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115554_990115564 13 Left 990115554 5:52385983-52386005 CCCCAGCTACCCTGAAGTTGTAA No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115551_990115564 30 Left 990115551 5:52385966-52385988 CCTCCGGTCTTCTTGTCCCCCAG No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115553_990115564 14 Left 990115553 5:52385982-52386004 CCCCCAGCTACCCTGAAGTTGTA No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115556_990115564 11 Left 990115556 5:52385985-52386007 CCAGCTACCCTGAAGTTGTAATC No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data
990115558_990115564 4 Left 990115558 5:52385992-52386014 CCCTGAAGTTGTAATCCATTGGC No data
Right 990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990115564 Original CRISPR CTGGAAAGAAGGAGAATAGC AGG Intergenic
No off target data available for this crispr