ID: 990119922

View in Genome Browser
Species Human (GRCh38)
Location 5:52438540-52438562
Sequence TCAATTTGCTAGAGTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990119922_990119924 -7 Left 990119922 5:52438540-52438562 CCTGGGGAACTCTAGCAAATTGA No data
Right 990119924 5:52438556-52438578 AAATTGAGCTCTGGAGAGTCTGG No data
990119922_990119925 -1 Left 990119922 5:52438540-52438562 CCTGGGGAACTCTAGCAAATTGA No data
Right 990119925 5:52438562-52438584 AGCTCTGGAGAGTCTGGAAAAGG No data
990119922_990119926 17 Left 990119922 5:52438540-52438562 CCTGGGGAACTCTAGCAAATTGA No data
Right 990119926 5:52438580-52438602 AAAGGTGCAAAAAAAAAAATTGG No data
990119922_990119928 19 Left 990119922 5:52438540-52438562 CCTGGGGAACTCTAGCAAATTGA No data
Right 990119928 5:52438582-52438604 AGGTGCAAAAAAAAAAATTGGGG No data
990119922_990119927 18 Left 990119922 5:52438540-52438562 CCTGGGGAACTCTAGCAAATTGA No data
Right 990119927 5:52438581-52438603 AAGGTGCAAAAAAAAAAATTGGG No data
990119922_990119929 22 Left 990119922 5:52438540-52438562 CCTGGGGAACTCTAGCAAATTGA No data
Right 990119929 5:52438585-52438607 TGCAAAAAAAAAAATTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990119922 Original CRISPR TCAATTTGCTAGAGTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr