ID: 990123426

View in Genome Browser
Species Human (GRCh38)
Location 5:52484335-52484357
Sequence CTTTCCTTCCTTTCTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990123426_990123429 5 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123429 5:52484363-52484385 AAAGAAGAAGGAGAATGAGGAGG No data
990123426_990123432 14 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123432 5:52484372-52484394 GGAGAATGAGGAGGGGAGAAAGG No data
990123426_990123428 2 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123428 5:52484360-52484382 GAGAAAGAAGAAGGAGAATGAGG No data
990123426_990123435 20 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123435 5:52484378-52484400 TGAGGAGGGGAGAAAGGAAGGGG No data
990123426_990123430 6 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG No data
990123426_990123431 7 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123431 5:52484365-52484387 AGAAGAAGGAGAATGAGGAGGGG No data
990123426_990123436 23 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123436 5:52484381-52484403 GGAGGGGAGAAAGGAAGGGGTGG No data
990123426_990123434 19 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123434 5:52484377-52484399 ATGAGGAGGGGAGAAAGGAAGGG No data
990123426_990123433 18 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123433 5:52484376-52484398 AATGAGGAGGGGAGAAAGGAAGG No data
990123426_990123427 -7 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123427 5:52484351-52484373 AGGAAAGAAGAGAAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990123426 Original CRISPR CTTTCCTTCCTTTCTCTCTC TGG (reversed) Intergenic
No off target data available for this crispr