ID: 990123430

View in Genome Browser
Species Human (GRCh38)
Location 5:52484364-52484386
Sequence AAGAAGAAGGAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990123426_990123430 6 Left 990123426 5:52484335-52484357 CCAGAGAGAGAAAGGAAGGAAAG No data
Right 990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990123430 Original CRISPR AAGAAGAAGGAGAATGAGGA GGG Intergenic
No off target data available for this crispr