ID: 990130699

View in Genome Browser
Species Human (GRCh38)
Location 5:52579573-52579595
Sequence TGAGGCACTTGTCAGAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990130699_990130706 7 Left 990130699 5:52579573-52579595 CCCGGTTTCTGACAAGTGCCTCA 0: 1
1: 0
2: 2
3: 18
4: 157
Right 990130706 5:52579603-52579625 GTTGCCAGTATTAACCAAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 51
990130699_990130705 4 Left 990130699 5:52579573-52579595 CCCGGTTTCTGACAAGTGCCTCA 0: 1
1: 0
2: 2
3: 18
4: 157
Right 990130705 5:52579600-52579622 GGAGTTGCCAGTATTAACCAAGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990130699 Original CRISPR TGAGGCACTTGTCAGAAACC GGG (reversed) Intergenic