ID: 990145729

View in Genome Browser
Species Human (GRCh38)
Location 5:52758168-52758190
Sequence GTTTTAGTCATCCCTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990145729_990145734 23 Left 990145729 5:52758168-52758190 CCGGCCTCAGGGATGACTAAAAC No data
Right 990145734 5:52758214-52758236 GCGTATACAGTTTTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990145729 Original CRISPR GTTTTAGTCATCCCTGAGGC CGG (reversed) Intergenic