ID: 990147147

View in Genome Browser
Species Human (GRCh38)
Location 5:52775211-52775233
Sequence GTTTGGTATCATGTAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990147147_990147150 -6 Left 990147147 5:52775211-52775233 CCCATGTTTACATGATACCAAAC No data
Right 990147150 5:52775228-52775250 CCAAACAGATCATATTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990147147 Original CRISPR GTTTGGTATCATGTAAACAT GGG (reversed) Intergenic
No off target data available for this crispr