ID: 990147439

View in Genome Browser
Species Human (GRCh38)
Location 5:52778558-52778580
Sequence TATAACCTAAACAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990147439_990147445 16 Left 990147439 5:52778558-52778580 CCCCCCACTTTGTTTAGGTTATA No data
Right 990147445 5:52778597-52778619 TAGTATTTTTTTGTTTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990147439 Original CRISPR TATAACCTAAACAAAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr