ID: 990149425

View in Genome Browser
Species Human (GRCh38)
Location 5:52800043-52800065
Sequence GGGGACGGGAGACGTGCGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990149419_990149425 -9 Left 990149419 5:52800029-52800051 CCCGCCTCTCCTTTGGGGACGGG 0: 1
1: 0
2: 2
3: 11
4: 191
Right 990149425 5:52800043-52800065 GGGGACGGGAGACGTGCGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 114
990149417_990149425 -8 Left 990149417 5:52800028-52800050 CCCCGCCTCTCCTTTGGGGACGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 990149425 5:52800043-52800065 GGGGACGGGAGACGTGCGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 114
990149421_990149425 -10 Left 990149421 5:52800030-52800052 CCGCCTCTCCTTTGGGGACGGGA 0: 1
1: 0
2: 1
3: 11
4: 130
Right 990149425 5:52800043-52800065 GGGGACGGGAGACGTGCGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 114
990149413_990149425 14 Left 990149413 5:52800006-52800028 CCTGCGCACGCGCGAACTGCGGC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 990149425 5:52800043-52800065 GGGGACGGGAGACGTGCGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990149425 Original CRISPR GGGGACGGGAGACGTGCGTC GGG Exonic