ID: 990149804

View in Genome Browser
Species Human (GRCh38)
Location 5:52803580-52803602
Sequence AGCTGCAACCTGGACACTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990149804 Original CRISPR AGCTGCAACCTGGACACTGA GGG (reversed) Exonic
904536345 1:31202044-31202066 AGCTCCAAGCTGGTCTCTGAGGG - Intronic
904873551 1:33636398-33636420 AGCTGCATCCTGGGGCCTGATGG - Exonic
906129530 1:43447853-43447875 GGCTCCTACCTGGACTCTGAGGG + Exonic
906844545 1:49177590-49177612 AGCTTCACGCTGGGCACTGAAGG - Intronic
908617996 1:65944892-65944914 AGCTGCTACCTGGTCACTTTGGG + Intronic
909713335 1:78677363-78677385 ATCTGCAACCTGGAGACTATAGG + Intergenic
910873326 1:91854456-91854478 AGCTCCAAGCTGGGCACTGGGGG - Intronic
913129968 1:115830219-115830241 AGCAGCAGCCTGGAGCCTGAGGG - Intergenic
916518469 1:165542072-165542094 TCCTGAAACCTGGACACTCATGG - Intergenic
923055456 1:230423459-230423481 AGCTGCATCCTGGCCACTTGGGG - Intronic
1063080714 10:2764761-2764783 AGCAGCCACCTGGGCTCTGAGGG - Intergenic
1063310770 10:4949766-4949788 AGCTGCAATCTGGATTCTGGGGG - Intronic
1065179434 10:23109691-23109713 AGTAGTAACCTGGGCACTGAGGG + Intronic
1065300602 10:24317698-24317720 ACCTTTAACCTGTACACTGATGG - Intronic
1066677578 10:37904151-37904173 AGCTGCAATAAGTACACTGATGG - Intergenic
1068769763 10:60807787-60807809 ACTTTCAACCTAGACACTGAGGG + Intergenic
1068961596 10:62872056-62872078 AGCTTCAACCTGGGCATTGGAGG + Intronic
1071860930 10:89671860-89671882 AGCTGAAAAATGGACACTGGAGG - Intergenic
1073640279 10:105245600-105245622 AGCAGCCACCTGGACTGTGATGG - Exonic
1075120922 10:119664107-119664129 AGCAGCAACATGGGCGCTGAGGG - Intronic
1075599778 10:123758948-123758970 ATCTGCTGCCTGGTCACTGAAGG + Intronic
1076271535 10:129156467-129156489 GACTGCAACCTGGACACTTTGGG + Intergenic
1076865938 10:133166267-133166289 GGCTGCAGCCTGGACACTATGGG - Intronic
1078060434 11:8039527-8039549 AGCTGAGACCAGGGCACTGAAGG + Intronic
1084929334 11:72542014-72542036 AGCTGCTACCTGGCCACTCTGGG - Intergenic
1084934155 11:72578189-72578211 AGCTGCACCCTGCACAGAGAGGG - Intronic
1085202892 11:74712489-74712511 AGCTTCATCCTGCACAGTGAGGG - Intronic
1085766969 11:79291667-79291689 GCCTGGAAGCTGGACACTGAAGG - Intronic
1086383504 11:86284432-86284454 AACTGCACCTTGGACAGTGAGGG + Intergenic
1088985085 11:114898880-114898902 AGCTGAAACCTGCCCACAGAGGG + Intergenic
1089821316 11:121229094-121229116 AGCTGGAATCTGGACTGTGAAGG + Intergenic
1090125845 11:124083050-124083072 AGCAGCACCCTGAACATTGATGG + Intergenic
1090215058 11:124954383-124954405 AGCTGCAACCCGGAGAAAGAGGG - Intronic
1091999832 12:5022938-5022960 ACCTGGAACCTGGATACTAATGG - Intergenic
1093744978 12:22729939-22729961 AGCTCTACCCTGGACACTCAGGG + Intergenic
1095755441 12:45761139-45761161 AGATTCAACTTGGACACTGAAGG - Intronic
1097341627 12:58444771-58444793 CTATGAAACCTGGACACTGAAGG + Intergenic
1097677622 12:62620006-62620028 AGAGGCAACCTGAAGACTGAGGG - Intergenic
1097918207 12:65042131-65042153 ACCTGCAGCCTGGACACCTAGGG - Intergenic
1102463996 12:113117323-113117345 AGCTCCTGCCAGGACACTGAGGG + Intronic
1105796768 13:23861925-23861947 AACTGCAACATTAACACTGATGG + Intronic
1105853559 13:24357568-24357590 AGGTGCCAGCTGGCCACTGAAGG - Intergenic
1105969197 13:25412768-25412790 AGGTCCTACCTGGACACTGTGGG - Intronic
1107040089 13:35938787-35938809 AGGTGAATCCTGGACACTAAAGG - Intronic
1108077355 13:46695106-46695128 TGCAGCAAGCTGGACATTGAAGG - Intronic
1109262795 13:60163813-60163835 AGCCGCAAGCTGGAAGCTGAGGG + Exonic
1109994796 13:70108742-70108764 ACCTGCAACCTGCAAACTGATGG - Intergenic
1110805324 13:79747774-79747796 GGCTGGAACCTGGAGACAGAAGG + Intergenic
1113553189 13:111209074-111209096 AGCTGGGACCTGGAGACTTAGGG + Intronic
1114065287 14:19054611-19054633 AGCTGCCACCTGCACACTCCTGG - Intergenic
1114096975 14:19345391-19345413 AGCTGCCACCTGCACACTCCTGG + Intergenic
1118319024 14:64742571-64742593 AGCTGGACCCTGGGCACTAAGGG + Intronic
1119734797 14:76975020-76975042 AGCTCCAACAGGGACGCTGATGG + Intergenic
1119738775 14:77000392-77000414 AGCTGCATCCTGGAGATTTATGG - Intergenic
1121908006 14:97765060-97765082 AGCTGCCCACTGGACCCTGAGGG - Intergenic
1202900251 14_GL000194v1_random:32348-32370 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1123552749 15:21398525-21398547 GGCTGCCACCTGGAGACTGATGG - Intergenic
1123588995 15:21835913-21835935 GGCTGCCACCTGGAGACTGATGG - Intergenic
1124997469 15:34737569-34737591 AGCTGCACCCAGGACACTGTTGG + Intergenic
1125680477 15:41527337-41527359 AGCTGGACCCTGGGCATTGATGG + Intronic
1125684186 15:41553518-41553540 AACTGCAGCCTGGTCAGTGAGGG - Intergenic
1129226954 15:74175702-74175724 AGCCCCAACGTGGGCACTGATGG + Exonic
1129669337 15:77598508-77598530 AGCTGCAGCCTGGACCCTCTTGG + Intergenic
1129890041 15:79065782-79065804 CCCTGCCACCTGGACACCGAGGG - Intronic
1130100475 15:80889917-80889939 AGCTGCATCCTGTGCACTCAAGG - Intronic
1131173167 15:90192448-90192470 AGATGTAGCCTGGACACTGCTGG + Intronic
1131461279 15:92619391-92619413 AGCTGCAACCTGGGGTGTGAAGG - Exonic
1131527934 15:93167474-93167496 GGCTGCAACTTGGAAGCTGATGG - Intergenic
1202961099 15_KI270727v1_random:125745-125767 GGCTGCCACCTGGAGACTGATGG - Intergenic
1133968106 16:10546445-10546467 GGCTGCAAGCTGGATACTAAAGG + Intronic
1135468103 16:22704501-22704523 AGCTGAGACCTGAACAGTGAGGG + Intergenic
1137311405 16:47263207-47263229 CTCTGCTACATGGACACTGAAGG + Intronic
1140965024 16:79957643-79957665 AGCTGGAACAGGGGCACTGAGGG - Intergenic
1141644302 16:85359056-85359078 GCCTGCACCCTGAACACTGAGGG - Intronic
1142018110 16:87762845-87762867 AGTTGCAAGCAGGACACTGAAGG - Intronic
1142375722 16:89706215-89706237 ACCTGCAGCCTGCACACTGTGGG - Intergenic
1143942711 17:10559348-10559370 AGCTGCAACCAGCATACTGATGG + Intergenic
1145254137 17:21313609-21313631 GGCTGCATCCTGCACACAGATGG + Intronic
1145322460 17:21774350-21774372 GGCTGCATCCTGCACACAGATGG - Intergenic
1146110500 17:30084802-30084824 AGCTGCCAACAGGACACTGGAGG + Intronic
1146204116 17:30886925-30886947 TTCTCCAACCTGAACACTGAAGG - Intronic
1146657090 17:34640945-34640967 TGCTACACCCTGGACCCTGATGG + Intergenic
1147350114 17:39835632-39835654 AGCTGCTCCCTGGACACGGACGG - Intronic
1147382865 17:40065846-40065868 GGCTGCAGCCTGCACCCTGAGGG - Intronic
1150318602 17:64190733-64190755 ACCTGCAGCCTGGGCACTGCTGG + Intronic
1151151989 17:72096048-72096070 AGCTGGAACCTGGAGGATGAGGG - Intergenic
1151675849 17:75596950-75596972 AGCTACAGCCTGGACACCCAGGG - Intergenic
1152393233 17:80015480-80015502 CGCTGCATCCTGATCACTGATGG + Intronic
1153062057 18:1004876-1004898 AGCTTCAACCTGGGCACTTCAGG - Intergenic
1153999041 18:10467937-10467959 AACTGCAGCCTGGGCAGTGATGG - Intronic
1154453662 18:14501922-14501944 GGCTGCCACCTGGAGACTGATGG - Intergenic
1155029553 18:21972450-21972472 ATCAGCAACCAGGACACAGAGGG - Intergenic
1155834940 18:30569248-30569270 AGCTGCTACCTGGGCACTTCAGG + Intergenic
1155878917 18:31119543-31119565 AGCAGTAACCTGGAGACTGACGG - Intergenic
1160378043 18:78429172-78429194 AGCTGCACCCTGGAGAAAGAGGG - Intergenic
1163742075 19:19021284-19021306 AGCTGCAACATGGACACAGACGG - Intronic
1164063826 19:21696891-21696913 AGCTGCAAACTGGAAATTCAAGG + Intergenic
1164589102 19:29496359-29496381 AGCTGCAGCCAGGACAGTGCTGG + Intergenic
1166328496 19:42065597-42065619 AGCTGAGACCTGGACCCTGACGG + Intronic
926019604 2:9483624-9483646 GGCTGCAAACAGGACAGTGAGGG - Intronic
926831886 2:16972120-16972142 AGCTGGAAACTGGACTGTGAAGG + Intergenic
930619095 2:53625768-53625790 AGCAGCAACCTGGAGGCAGAGGG - Intronic
931426986 2:62180209-62180231 AGATGAAAAATGGACACTGAAGG - Intergenic
934887375 2:98036765-98036787 AGTAGCAACCTGGTCACAGAAGG - Intergenic
936142015 2:109948638-109948660 AGATGCAGCATGGACCCTGAGGG - Intergenic
936178705 2:110246598-110246620 AGATGCAGCATGGACCCTGAGGG - Intergenic
936202673 2:110422834-110422856 AGATGCAGCATGGACCCTGAGGG + Intronic
937439313 2:121903183-121903205 AGCTGGCACCCAGACACTGAGGG - Intergenic
938548008 2:132352808-132352830 AGCTGCTGCCTGCACACAGAGGG - Intergenic
941020423 2:160402628-160402650 ATCTGAAATCTGGACACTGTGGG + Intronic
942870524 2:180728945-180728967 AGCTGCAACCTTCAAACTCAGGG + Intergenic
944432387 2:199647137-199647159 AGGTACCACCTGGACATTGAAGG + Intergenic
944484887 2:200195144-200195166 AGCAGCTTCCTGCACACTGAAGG + Intergenic
944683992 2:202101731-202101753 AGCCGGCACCTGGACAGTGAGGG + Intronic
946840613 2:223816074-223816096 CGCTCCAGCCTGGACACTAAAGG + Intronic
948083237 2:235224930-235224952 AGCTGGAGCCTGGACAGGGATGG - Intergenic
948884131 2:240874534-240874556 AGCTGCAGCCTGGCAACTGGAGG + Intronic
1170159267 20:13295861-13295883 AGGTGCAACCTGGAGGCTGCTGG + Intronic
1170463581 20:16601852-16601874 AACTGTATTCTGGACACTGATGG - Intergenic
1171333309 20:24360376-24360398 TGCAGCAACATGGACACTGCTGG + Intergenic
1171876875 20:30585580-30585602 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1176093498 20:63329233-63329255 GGCTGCAACCAGGCCACTGTGGG - Intronic
1176289054 21:5034640-5034662 AGCTGCCACCTGGCCTCTCACGG - Intronic
1176619623 21:9047126-9047148 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1176665402 21:9682251-9682273 GGCTGCACCCTGGAGACTCAGGG + Intergenic
1176820520 21:13651383-13651405 GGCTGCCACCTGGAGACTGATGG + Intergenic
1178194999 21:30334738-30334760 ACCTGCAACCTGGAAACTCAAGG + Intergenic
1179192692 21:39136841-39136863 AGCTGAAACCTGAACTCTGCAGG + Intergenic
1179868181 21:44228964-44228986 AGCTGCCACCTGGCCTCTCACGG + Intronic
1180127719 21:45803594-45803616 AAATGCAAACAGGACACTGAGGG + Intronic
1180354683 22:11829154-11829176 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1180383569 22:12163178-12163200 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1180483778 22:15777231-15777253 AGCTGCCACCTGCACACTCCTGG - Intergenic
1184539080 22:45107813-45107835 GGCTGCAACCTGGTGAGTGAGGG - Intergenic
950392500 3:12707665-12707687 AGCTGCCACCTGGTCACTTCAGG - Intergenic
950697582 3:14715243-14715265 AGCTGCCACCGGGCCCCTGAAGG - Intronic
951494244 3:23308774-23308796 ATCTGCAAGCTGGAGAATGATGG + Intronic
954574865 3:51670487-51670509 AGCCACAACCTGGGCACTGAGGG + Intronic
954628959 3:52038012-52038034 AGCGGCTACCTTGAAACTGAAGG + Intergenic
960891866 3:122457606-122457628 ACCTGAAATCTGCACACTGAAGG + Intronic
961640355 3:128361027-128361049 AGCTGCAGCCTGGACATGCAGGG + Intronic
967871272 3:194231895-194231917 AGCAGCAGCCTCCACACTGAGGG - Intergenic
968635032 4:1673807-1673829 AGCTGCTGCCTTGACACTGCTGG - Intronic
968909276 4:3469380-3469402 GGCTGCAACCTGGCCAGGGAAGG - Intronic
972873043 4:43324340-43324362 TCCAGCAACCTAGACACTGAAGG + Intergenic
973373480 4:49271478-49271500 AGCTGCTGCCTGCACACAGAGGG + Intergenic
973387533 4:49523730-49523752 AGCTGCTGCCTGCACACAGAGGG - Intergenic
975399266 4:73915907-73915929 AGCTGCCACCTGGTCACTTTGGG + Intergenic
977293841 4:95191393-95191415 AGCTTCAGCCTGGACCCTGGGGG - Intronic
977700983 4:100022474-100022496 AGCTTCAACCTGAACTTTGAAGG + Intergenic
979343435 4:119556382-119556404 AGCTGCATCCTTGACCCTGAAGG + Intronic
981804027 4:148691757-148691779 AACTGTAAGCTGGACACTGAGGG - Intergenic
984657496 4:182335036-182335058 AGCTGCCACCTGGGCACCAAGGG - Intronic
985410892 4:189682712-189682734 GGCTGCACCCTGGAGACTCAGGG + Intergenic
1202760288 4_GL000008v2_random:103166-103188 AACAGCAACCCAGACACTGAAGG - Intergenic
985560029 5:580572-580594 AGCTGAAACTTGAACACTGAGGG - Intergenic
988366415 5:30305992-30306014 ATCTGCAAGCTGGATGCTGAGGG - Intergenic
990149804 5:52803580-52803602 AGCTGCAACCTGGACACTGAGGG - Exonic
991369430 5:65902903-65902925 ATCTGCAAACTGGAGACTGTGGG - Intergenic
993496194 5:88611731-88611753 TGCTGCAGCCTGGAGACTGTGGG + Intergenic
997814361 5:137001620-137001642 AGCAACAACTTGTACACTGAGGG - Intronic
999936990 5:156497816-156497838 AGCTGTGACCCAGACACTGATGG + Intronic
1002100262 5:176854152-176854174 AGTTGCCACCTGGACTCTCATGG + Intronic
1004235910 6:13874038-13874060 GGCTTCCACCTGGACAGTGACGG + Intergenic
1005391682 6:25340300-25340322 AGCTACACACTGAACACTGAAGG - Intronic
1005840760 6:29743372-29743394 AGCTGCAAAGTGGACAGAGATGG + Intergenic
1006060123 6:31413060-31413082 AGCTGCAAAGTGGACAGAGATGG - Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1010465598 6:76164463-76164485 GGCTGGAACATGGACAGTGAGGG + Intergenic
1012109546 6:95211664-95211686 AGCTAAAAACTGGACACAGAAGG + Intergenic
1019568897 7:1699337-1699359 GGCTGCAACTTGGAAACTGCTGG - Intronic
1020683553 7:11266261-11266283 AGCTGCAACATGGACACAGCTGG - Intergenic
1023842039 7:44103542-44103564 AGCTGCCACATGGACCCAGAGGG - Intergenic
1024736742 7:52313197-52313219 AGCTTCAACATGTAAACTGATGG - Intergenic
1024913182 7:54469464-54469486 AGCTGAAACCAGGACACTTGAGG - Intergenic
1026849096 7:73713863-73713885 AGCTGCCACCTGCACAGCGAAGG - Intronic
1030815751 7:114034942-114034964 AGCTCCATCCTGAACCCTGAGGG - Intronic
1034955728 7:155333302-155333324 AGGTGCAACCCGCACACAGATGG + Intergenic
1036462170 8:8963233-8963255 CTCTGCAAACTGGACAGTGAAGG - Intergenic
1036591337 8:10171582-10171604 TGCAGCAACTTGGTCACTGAGGG - Intronic
1038938539 8:32278844-32278866 AGCTGCCACCTGCACAGTGGTGG - Intronic
1041475493 8:58260658-58260680 GACAGCAACCTGGACACTAAGGG - Intergenic
1045706973 8:104935431-104935453 AGTTGCAAACTGGAAACTGAAGG + Intronic
1046287007 8:112107193-112107215 TGCAGCAACCTGCACACTGGTGG - Intergenic
1053515050 9:38723390-38723412 AGCTGCACCCAGGACACAGCAGG - Intergenic
1053752429 9:41269623-41269645 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1053752876 9:41273883-41273905 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1054257956 9:62833955-62833977 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1054258398 9:62838232-62838254 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1054333374 9:63781825-63781847 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1054351481 9:64020855-64020877 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1057423873 9:94933244-94933266 AGCTGCACCCTGGAGACAGGAGG - Intronic
1057684914 9:97222591-97222613 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1061158352 9:128878973-128878995 AGCTGCAAGCTGGGGAATGAGGG + Intronic
1062010490 9:134264283-134264305 AGCTGGTACCTGGAGACTCAGGG + Intergenic
1062173625 9:135148882-135148904 AGCAGCAAGCTGGACACTAGAGG + Intergenic
1202800817 9_KI270719v1_random:174425-174447 AGCTGCTGCCTGCACACGGAGGG - Intergenic
1203526730 Un_GL000213v1:97538-97560 GGCTGCCACCTGGAGACTGATGG - Intergenic
1203697189 Un_GL000214v1:109481-109503 AGCTGCTGCCTGCACACAGAGGG + Intergenic
1203552026 Un_KI270743v1:171548-171570 AGCTGCTGCCTGCACACAGAGGG - Intergenic
1203660697 Un_KI270753v1:39509-39531 GGCTGCACCCTGGAGACTCAGGG - Intergenic
1203671870 Un_KI270755v1:22724-22746 GGCTGCACCCTGGAGACTCAGGG - Intergenic
1185737442 X:2503991-2504013 GGGTGCAACCTGCACACTGGGGG - Intergenic
1186828471 X:13365584-13365606 AGCAGCCACCTGGAAACTGATGG - Intergenic
1192324739 X:70122826-70122848 GGCTGCAATCTGGACACTTTGGG - Intergenic
1194990550 X:100542905-100542927 AGCTGAAACCTGCCCACAGAGGG + Intergenic
1197117654 X:122852123-122852145 AGCTGCTACCTGCCCACGGAGGG + Intergenic
1198185975 X:134254422-134254444 GGCTGCAGCCTGGACACTTTGGG - Intergenic
1199587294 X:149429284-149429306 AGCAGCAACCTGGACAGAGTTGG + Intergenic
1199795597 X:151192301-151192323 AGGTGCCACCTGGACAGTGTTGG - Intergenic
1199879199 X:151959528-151959550 AGTTGTAACCTCGAAACTGAAGG + Intronic
1201153294 Y:11107118-11107140 AGCTGCTGCCTGCACACAGAGGG - Intergenic