ID: 990155036

View in Genome Browser
Species Human (GRCh38)
Location 5:52867329-52867351
Sequence TAAGGTTATAAATATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990155031_990155036 17 Left 990155031 5:52867289-52867311 CCAAGGCTGAATAGGTCTCTGTA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 990155036 5:52867329-52867351 TAAGGTTATAAATATCCTGCTGG 0: 1
1: 0
2: 2
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990155036 Original CRISPR TAAGGTTATAAATATCCTGC TGG Intronic
909923243 1:81407364-81407386 TGAGGTTAAAAAGATCCTGTTGG + Intronic
911860621 1:102943296-102943318 TAAAGGTATAAATACCCAGCAGG + Intronic
912079726 1:105920132-105920154 AAAGGATATTACTATCCTGCTGG + Intergenic
912827413 1:112918440-112918462 TATGGTTATAATAATCCTTCCGG - Intronic
916006584 1:160666670-160666692 CACGCTTATAAATATCCTGCAGG + Intergenic
916338922 1:163706339-163706361 TAAAATTATAAATATCTGGCTGG - Intergenic
919368729 1:196698848-196698870 TAAGCTTTTAGATATGCTGCTGG - Intronic
921693795 1:218183785-218183807 TTATGTTATATACATCCTGCTGG - Intergenic
921772237 1:219054488-219054510 GAATATTATAAATATCCTACTGG + Intergenic
922326026 1:224529347-224529369 GATGCTGATAAATATCCTGCAGG - Intronic
922853061 1:228750696-228750718 TAAGGTTTAAAATATCCTCCAGG - Intergenic
1065762579 10:28996075-28996097 TAAGATTCTAAATATATTGCTGG + Intergenic
1068730023 10:60347544-60347566 TGAGGATAAAAATATCCTACAGG + Intronic
1070911473 10:80122510-80122532 GTAGGTTATAAATCTCCTGAGGG - Intergenic
1071000060 10:80821430-80821452 TAAGCTTGTTAATATGCTGCTGG - Intergenic
1071308698 10:84323458-84323480 TCAGGGTATACACATCCTGCTGG - Intergenic
1074988563 10:118680524-118680546 TAAGGTTACAAATAACCTAGGGG + Exonic
1076019283 10:127057212-127057234 CAAGGTAATAAACATGCTGCAGG - Intronic
1079696462 11:23487801-23487823 TAAGCTTTTTAATGTCCTGCTGG - Intergenic
1085723006 11:78929656-78929678 AATGGTTTTTAATATCCTGCTGG + Intronic
1086496876 11:87413073-87413095 TAAGCTTTTTAATATGCTGCTGG - Intergenic
1087830629 11:102816234-102816256 TAAGGTTTTTAATGTGCTGCTGG + Intergenic
1090918335 11:131186600-131186622 TAAAGTCATAAATATCCTACAGG + Intergenic
1091128734 11:133125458-133125480 TGATGATATAAATATCTTGCAGG - Intronic
1093982958 12:25495459-25495481 TCTGTTTATAAATATCTTGCAGG - Intronic
1095266539 12:40165565-40165587 TAAGATTAGAAATTTTCTGCAGG - Intergenic
1096051313 12:48611345-48611367 TAAGGTTTTTGATATGCTGCTGG + Intergenic
1098694977 12:73540957-73540979 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1101058171 12:100941790-100941812 TAAGGATTTTCATATCCTGCAGG - Intronic
1102887792 12:116534567-116534589 TGAGCATATAAATTTCCTGCGGG - Intergenic
1103052003 12:117788456-117788478 TAAGCTTTGAAAAATCCTGCAGG + Intronic
1104679442 12:130739402-130739424 TAAGGTCATAGTTATCCTGGAGG - Intergenic
1109731914 13:66423451-66423473 TAAGCTTTTTAATATGCTGCTGG - Intronic
1109943340 13:69399833-69399855 TAAGCTTTTTAATGTCCTGCTGG - Intergenic
1112166195 13:96922490-96922512 TAAGGTTTTTAATGTGCTGCTGG - Intergenic
1113235116 13:108263892-108263914 TAAGGACATAATTGTCCTGCTGG - Intronic
1115056538 14:29134844-29134866 TAAGCTTTTTAATATGCTGCTGG + Intergenic
1116342806 14:43747152-43747174 TCAGTTTATAAATATTCAGCTGG + Intergenic
1116756046 14:48949494-48949516 TGAGGTTATAAATCTCTTGCAGG - Intergenic
1117929442 14:60824349-60824371 TTAGGTTATAAACATCTTGAGGG + Intronic
1120724905 14:87927577-87927599 GAAGGTTATAAAGACACTGCAGG + Intronic
1121284409 14:92724180-92724202 TAAAGTTATATATTTTCTGCAGG + Intronic
1121918401 14:97857340-97857362 TTAGGTTAAAAATATCCTTTAGG + Intergenic
1123098819 14:105780752-105780774 TAATGTTTTTAATATGCTGCTGG + Intergenic
1133878236 16:9755705-9755727 TAATGTTTAACATATCCTGCAGG - Intronic
1139299089 16:65929169-65929191 TAAGCTTTTAGATATGCTGCTGG - Intergenic
1140545949 16:75809342-75809364 TAAGATTATAAATTTCTTGGGGG - Intergenic
1141321215 16:83010763-83010785 TATGATTAGAAACATCCTGCGGG + Intronic
1141897054 16:86964894-86964916 TATGGTGATAAATCTCCCGCCGG + Intergenic
1142985925 17:3695441-3695463 TGTGATTATAAATAACCTGCCGG + Intronic
1143928225 17:10392480-10392502 TAAGGTTTTCAATTTCCTTCTGG + Intronic
1143930382 17:10417008-10417030 TAAGGTCAAATATATCCTCCTGG + Intronic
1144499893 17:15777140-15777162 AAAGGTAATAAATATCTTCCTGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149857517 17:60095906-60095928 TATGGTTTGAAATATCATGCTGG - Intergenic
1151033939 17:70776254-70776276 TAAGGATATTAATCTCCTGTTGG - Intergenic
1153584112 18:6603475-6603497 TAAGGTTCCAAAAATTCTGCAGG + Intergenic
1153702017 18:7704041-7704063 TAAGGTTTTTGATATGCTGCTGG + Intronic
1154503703 18:15010950-15010972 GAAGATTATAAATAGCCAGCAGG + Intergenic
1158028367 18:52931209-52931231 TAAAGTTAGGATTATCCTGCAGG + Intronic
1160568608 18:79801549-79801571 GAAGGTTAAAAATATCCAGAAGG - Intergenic
927031979 2:19130146-19130168 GTAGGTTTTAAATATCCTTCAGG + Intergenic
932526673 2:72476917-72476939 TCTGCCTATAAATATCCTGCTGG + Intronic
935261348 2:101358400-101358422 TAAACTTTTAAATATCATGCTGG + Intronic
935959736 2:108413248-108413270 AAATTTTGTAAATATCCTGCAGG - Intergenic
935961820 2:108433121-108433143 TAAGGTTTTTGATATGCTGCTGG - Intergenic
936877467 2:117209192-117209214 TAAGGGAATAAATTTCCTCCTGG - Intergenic
940054210 2:149496636-149496658 TAAGCTTTTTAATATGCTGCTGG + Intergenic
940257542 2:151747102-151747124 TAAGCTTTTTGATATCCTGCTGG - Intergenic
941330101 2:164169554-164169576 TAAGGATATCACTATCCTGCAGG + Intergenic
945178047 2:207063463-207063485 TTGAGTTATAAATATCCTGAAGG - Intergenic
945180291 2:207084747-207084769 TAAAGTTATAAATACCCTCTAGG - Intronic
947463938 2:230325094-230325116 TGAAGTTCTAAAAATCCTGCTGG - Intergenic
1168915216 20:1479889-1479911 TAAAGTTATAAATTTCCTGTTGG + Exonic
1169053074 20:2596904-2596926 TGAGGTAATAAAAAGCCTGCAGG - Intronic
1169463460 20:5817095-5817117 TAATATTATAAATATCCTCAAGG - Intronic
1171513040 20:25703060-25703082 TAAGTTTTTTAATGTCCTGCTGG + Intergenic
1172120594 20:32596488-32596510 TAAGGTTATAGAGATGCTGGTGG - Intronic
1172525116 20:35596052-35596074 TACAGTTTTAAATAGCCTGCAGG - Intergenic
1172559312 20:35872224-35872246 TAAAGTTATAAATTTCTGGCTGG + Intronic
1172718904 20:36984433-36984455 AAAGGACATAAATATCCTCCTGG + Intergenic
1176698471 21:10010808-10010830 TAAGCTGATAAATATTCTACTGG - Intergenic
1177404025 21:20642780-20642802 TAAGGTTAAAAAAATGCTGTAGG + Intergenic
1179332159 21:40413587-40413609 TTAGTTTGTCAATATCCTGCTGG - Intronic
950935060 3:16830921-16830943 TTAAATTATAAATATCCTGGTGG - Intronic
952721168 3:36534428-36534450 TAGGGTTATAAATATCATATTGG - Intronic
952780397 3:37091523-37091545 TAAGGTCATAGATATCCTGCAGG + Exonic
953506353 3:43489375-43489397 TAAGGTTATAAAAATAATGCAGG - Intronic
955931335 3:64060060-64060082 TAAGGTTATAAATCCTCTGTAGG + Intergenic
956627949 3:71285367-71285389 TAAAGTTAGAATTATCCTGCTGG - Intronic
957850354 3:85799638-85799660 TAAGGTTTTTAATGTGCTGCTGG + Intronic
957940804 3:87001333-87001355 TCAGGTAATAACAATCCTGCTGG - Intergenic
958523581 3:95223553-95223575 TAAGCTTTTTGATATCCTGCTGG + Intergenic
958640912 3:96803321-96803343 TAAATTTGTACATATCCTGCCGG + Intergenic
960492847 3:118338147-118338169 TAATGGTATAAAAATGCTGCAGG + Intergenic
962029005 3:131579485-131579507 TAAGGTTATAACTATCATTACGG + Intronic
963734997 3:149009340-149009362 TTAGGTTATAAATAAACGGCAGG - Exonic
963854601 3:150240832-150240854 TAAGCTTAGAAATTTTCTGCAGG - Intergenic
964250775 3:154714195-154714217 CAAGGTTATAGAGATCATGCAGG - Intergenic
965163534 3:165166165-165166187 TAAGGTTTTTGATATGCTGCTGG + Intergenic
965426508 3:168530673-168530695 ACAGGTTATAAATGTTCTGCTGG + Intergenic
969049362 4:4361765-4361787 CAAGGGTATGAATATCCTGGTGG - Intronic
969729607 4:8946455-8946477 TATTGTTTTAAATATCCAGCGGG - Intergenic
970305026 4:14722489-14722511 TAAGCTTTTTAATATGCTGCTGG - Intergenic
970494656 4:16612975-16612997 TAAGGTTTTCAATGTGCTGCTGG - Intronic
970756026 4:19428208-19428230 CAGAGTTATAAATTTCCTGCTGG + Intergenic
975479212 4:74859145-74859167 TAAGGTTTTACATGTCATGCTGG - Intergenic
975532520 4:75415470-75415492 TTAGATTATAAATTTCCTGAAGG - Intergenic
976043383 4:80914671-80914693 TGAGGAAATAAATAACCTGCAGG - Intronic
976716365 4:88126550-88126572 TAAGGTTTTTGATATGCTGCTGG - Intronic
979079998 4:116325645-116325667 TCAGGTTATTAATTTCCTGAGGG - Intergenic
980370961 4:131870292-131870314 TAAGCTGATAAATATTCTACTGG - Intergenic
983698865 4:170566866-170566888 TAAAGCTAAAAATATCCTGTGGG + Intergenic
983803094 4:171960725-171960747 TAAGGTTCTAAAAATCCTGCTGG - Intronic
984354534 4:178640750-178640772 TAAGCTTTTTAATATGCTGCTGG - Intergenic
984395450 4:179192276-179192298 TAAGATTACAAATATCCAACAGG - Intergenic
984532559 4:180934329-180934351 TAAGGTTGTAAATATTCTAAGGG - Intergenic
985941041 5:3136347-3136369 GCAGGTTATTAATATCCTGATGG - Intergenic
985941042 5:3136350-3136372 TCAGGATATTAATAACCTGCAGG + Intergenic
987542971 5:19278538-19278560 CAAAGCTATAAAAATCCTGCAGG + Intergenic
987819334 5:22941773-22941795 TTGGGTTATAAACATCTTGCAGG + Intergenic
990155036 5:52867329-52867351 TAAGGTTATAAATATCCTGCTGG + Intronic
991201908 5:64004580-64004602 TAATACTAAAAATATCCTGCAGG - Intergenic
992087183 5:73288520-73288542 TAAGGTTAGACAATTCCTGCAGG - Intergenic
992309869 5:75485805-75485827 TAAGGTTTTAAATTTCTTCCTGG - Intronic
994202716 5:96996344-96996366 TGAGGCTGTAAATATCCTGTGGG + Intronic
994393805 5:99212446-99212468 TAAGGTTTCTAATATCCTGTGGG - Intergenic
994437724 5:99760268-99760290 TAAGCTTTTTAATATGCTGCTGG + Intergenic
994550936 5:101234172-101234194 TAAGTTTTTTAATATGCTGCTGG + Intergenic
994611286 5:102044241-102044263 TAAGGTTTTTAATGTGCTGCTGG - Intergenic
996315590 5:122157388-122157410 CAAGTTCATAAAAATCCTGCTGG - Intronic
998344251 5:141447431-141447453 TGAGGTTAAAAATTTCCTCCGGG - Intronic
998972425 5:147607542-147607564 TAAGGTTTTTAATGTGCTGCTGG + Intronic
1006265580 6:32919387-32919409 TAAGGTTAAAAATAAAGTGCAGG - Intergenic
1008424870 6:51345645-51345667 TAAGCTTTTTAATATGCTGCTGG + Intergenic
1008731795 6:54491694-54491716 TTAGGCTCTAAATATTCTGCAGG - Intergenic
1008826619 6:55702219-55702241 TAAGGTCAGAAAGATCATGCAGG + Intergenic
1008865780 6:56207807-56207829 TAAGGTTTTTGATATGCTGCTGG - Intronic
1009568006 6:65338863-65338885 GTATGTTATAAATATCCTTCAGG - Intronic
1010150346 6:72724394-72724416 TAATTTTATAAATAACTTGCAGG + Intronic
1010575263 6:77522198-77522220 TAAGCTTTTCAATATGCTGCTGG - Intergenic
1010588273 6:77681252-77681274 TAAGGCTATATATACCCTGGCGG - Intergenic
1010708056 6:79137798-79137820 TAAGGTTTTTAATGTGCTGCTGG - Intergenic
1010838227 6:80615832-80615854 TAAGGTTTTTAATGTACTGCTGG - Intergenic
1014572199 6:123023487-123023509 TTAGGTTATAAATAACCTTATGG - Intronic
1015615868 6:135074496-135074518 TAAGATTATACATATCATCCTGG + Intronic
1016311385 6:142737507-142737529 AAAGTTGATAAATATCCAGCTGG - Intergenic
1016429240 6:143965288-143965310 GAAGCTTATAAAGACCCTGCTGG + Exonic
1022768145 7:33438957-33438979 TAAAGTGATAAAAATCCTGTGGG - Intronic
1024239406 7:47422678-47422700 TAATGTTATAAACAAGCTGCTGG + Intronic
1027583216 7:80023847-80023869 TAAGCTTATTAATGTGCTGCTGG - Intergenic
1027731616 7:81881463-81881485 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1027753325 7:82179697-82179719 AAAAGTTATTAATATGCTGCTGG - Intronic
1028674310 7:93441649-93441671 TCAGGCTATCACTATCCTGCTGG - Intronic
1028779183 7:94716476-94716498 TAAGCTTTTTAATATGCTGCTGG + Intergenic
1039820063 8:41127104-41127126 TAGGGTTGTAAACAACCTGCAGG + Intergenic
1040842262 8:51796947-51796969 TAAGCTTTTAAATGTGCTGCTGG - Intronic
1041346460 8:56903613-56903635 TAAAGATATAAATATCCTGAGGG - Intergenic
1042116450 8:65437067-65437089 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1043131941 8:76472966-76472988 TAAGGTTAAAAATCTCCTAGGGG + Intergenic
1043463594 8:80485415-80485437 TAACGTTATAAATATTAGGCAGG - Intergenic
1044713994 8:95083627-95083649 TAAGGTTTTAAATATTTTGATGG - Intronic
1044935299 8:97288143-97288165 TATGTTTATAAATCTTCTGCAGG - Intergenic
1045184167 8:99819113-99819135 TAAGCTTAGAAATAACCAGCAGG + Intronic
1046610737 8:116422066-116422088 AAAGGTTAAAAAAATCCTGCTGG - Intergenic
1048055514 8:130859286-130859308 GAAAGTTAGAAATATCCTGGTGG - Intronic
1050576689 9:7003926-7003948 TATGGTTTCAAACATCCTGCAGG - Intronic
1051269015 9:15336833-15336855 CAAGGTTCAAAATAGCCTGCTGG + Intergenic
1051932437 9:22402412-22402434 TAAGGTTGTAAATATCATTTGGG + Intergenic
1053770389 9:41467476-41467498 TAAGCTGATAAATATTCTACTGG + Intergenic
1054316465 9:63594265-63594287 TAAGCTGATAAATATTCTACTGG - Intergenic
1054549064 9:66378981-66379003 TAAGCTGATAAATATTCTACTGG + Intergenic
1055694655 9:78870824-78870846 TAAGATTATCAATATTCAGCAGG - Intergenic
1056744112 9:89285379-89285401 TAAGGTTGTGTATATCCTGAGGG - Intergenic
1058068450 9:100575661-100575683 TTAGGTTGTAAATTTCTTGCTGG + Intronic
1058154822 9:101503469-101503491 TAAGGTTATAATTTTCATGTTGG + Intronic
1058484401 9:105428998-105429020 TAAAGTTATGAATAACCGGCCGG - Intronic
1058963118 9:110010127-110010149 TATGTTTATAAATATCCATCAGG - Intronic
1061658936 9:132114954-132114976 TAATGATATCAATATACTGCAGG + Intergenic
1185586800 X:1246999-1247021 TACGGTAATAAAAATCCGGCGGG + Intergenic
1186011315 X:5137264-5137286 TAAGGCTGTAAATATCCCTCAGG - Intergenic
1187298114 X:18022339-18022361 TAATATTTTAAATATCCTCCTGG + Intergenic
1187801780 X:23071736-23071758 TCAGGGTTTAAATTTCCTGCTGG - Intergenic
1189629400 X:42935284-42935306 TAAGTTTATGAATGTCCTGATGG + Intergenic
1191032728 X:55991719-55991741 AAAGGGAATAAATATCCTGCTGG - Intergenic
1191039170 X:56060554-56060576 TAAGCTTTTTGATATCCTGCTGG + Intergenic
1191644934 X:63470185-63470207 TAAGGTTATAAATTTCCCTTTGG - Intergenic
1191925782 X:66308179-66308201 TAAGGTTTTTGATATGCTGCTGG + Intergenic
1192683339 X:73277533-73277555 TAAATTTAAAAATATACTGCTGG + Intergenic
1193296803 X:79842927-79842949 TAAGCTTCTTAATATGCTGCTGG - Intergenic
1195195293 X:102491741-102491763 TAATCTTTTAAATATGCTGCTGG + Intergenic
1196322463 X:114357597-114357619 TAAAGTTATGAATGTCTTGCTGG + Intergenic
1199889218 X:152058390-152058412 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1200878834 Y:8190233-8190255 TAAGGTTTTTGATATGCTGCTGG + Intergenic