ID: 990155806

View in Genome Browser
Species Human (GRCh38)
Location 5:52876053-52876075
Sequence GTGAAAATCCTCAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990155806 Original CRISPR GTGAAAATCCTCAAGGAGGA AGG (reversed) Intronic
900475617 1:2875055-2875077 GTGAAGACCCTCTAGAAGGAGGG + Intergenic
900906677 1:5564361-5564383 GGGAAAAACTTGAAGGAGGACGG - Intergenic
903131379 1:21281611-21281633 ATGAGAAGCCTAAAGGAGGAAGG - Intronic
903934925 1:26889096-26889118 GTGAGAATCCACGAGGTGGACGG + Exonic
905846524 1:41238465-41238487 GTGCAAACCTTGAAGGAGGAGGG - Intronic
906193278 1:43912857-43912879 GGGACATTCCTGAAGGAGGAGGG + Intronic
908818460 1:68057805-68057827 GTGAATACCCTCAGGGAGGCAGG + Intergenic
910038761 1:82821809-82821831 GTGAAAATCTTTAAGGAAGAAGG + Intergenic
910615185 1:89189869-89189891 GTGACAATCCTCTAGAAGAAGGG + Intronic
911310649 1:96288775-96288797 GTGAAAGTCCACAGGGAGGCAGG - Intergenic
914390351 1:147215922-147215944 AGGAAAATCCTGAAGAAGGAAGG - Exonic
915376690 1:155402367-155402389 CTTAAAATCCTCAAGGAATACGG + Intronic
915813351 1:158939594-158939616 GTGAAAATCCTAAAGGAAAAAGG - Intronic
915846899 1:159276252-159276274 GATAAAATCTTCAAGGAAGATGG + Intergenic
916330653 1:163612508-163612530 GTGAAAATCATCCAGGGGAAAGG + Intergenic
916644065 1:166764605-166764627 GTTAAACTCCTCAGGGAGGATGG - Intergenic
917434491 1:175005966-175005988 GTGAAAAACGTCATGGAGGATGG + Intronic
918427235 1:184423232-184423254 GTGAAGTTCCTGAATGAGGAAGG - Intronic
920249292 1:204612420-204612442 GGTAAAATCATCAAGAAGGAAGG + Intergenic
920906872 1:210178867-210178889 GAAAAAATACTCAAGGAGGCTGG + Intergenic
921148103 1:212378318-212378340 GGGAAAGTCTTCCAGGAGGAAGG + Intronic
921628705 1:217407312-217407334 TTGAAAATCCACAAGGCAGAAGG - Intergenic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
1067174906 10:43938867-43938889 GGAAAAATACCCAAGGAGGATGG + Intergenic
1068589102 10:58835185-58835207 GTTAAATTCCTAAACGAGGAGGG + Intergenic
1068705863 10:60074612-60074634 GTGGAAGTCCTCATGGAGGCTGG + Exonic
1070187796 10:74083043-74083065 GTGAAAAACCTAAAGTAGGTTGG + Intronic
1070269105 10:74934668-74934690 GAGAAAAGGCTCAAGGAAGAAGG - Intronic
1070584474 10:77751845-77751867 ATAAAAATCCTCAGGGAGGCGGG + Intergenic
1073853027 10:107643344-107643366 TTTAAAATCCTAAAGGATGAAGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1077702612 11:4455870-4455892 GGGAAGTTCCTCTAGGAGGAGGG + Intergenic
1085690158 11:78657780-78657802 GGAAAAATCCTCAAGGAAAAAGG + Exonic
1085998116 11:81947157-81947179 GTGAAAATCCAGATTGAGGATGG - Intergenic
1086869638 11:92021473-92021495 TTGAAACTCCAGAAGGAGGAGGG - Intergenic
1088627969 11:111746039-111746061 GAGAAAATCCGAAAAGAGGAAGG + Intronic
1089060859 11:115624975-115624997 GTGAAAATGGTGAAAGAGGACGG - Intergenic
1089150442 11:116359798-116359820 GTGAAAATCTAGAAGCAGGAAGG + Intergenic
1089656550 11:119951224-119951246 GTGCAAAATCTCAAGGAAGAGGG + Intergenic
1090304960 11:125683411-125683433 CTGAAAATCTTCAGGGTGGAGGG + Intergenic
1090461437 11:126894983-126895005 TTGAAAATCCCCAGAGAGGATGG - Intronic
1092257800 12:6936794-6936816 GGGGAAATGCTCCAGGAGGAGGG - Exonic
1092346006 12:7715064-7715086 GGGAAATTCCTCAGGGTGGAAGG - Intronic
1092384979 12:8029316-8029338 GTTAAATGCCTGAAGGAGGAAGG - Intergenic
1097036714 12:56129122-56129144 GTAAAAAGTCTCGAGGAGGATGG - Intronic
1097171197 12:57114231-57114253 GTGAAAATGGCCAAGGAGGGAGG - Intronic
1099201796 12:79686912-79686934 GTGTATATTCTCAAGGAGCAAGG - Intronic
1099311483 12:81031345-81031367 GTGAAAATCCCCAATGAGGCAGG - Intronic
1101760525 12:107655012-107655034 GTGACCATGGTCAAGGAGGAGGG - Intronic
1102402391 12:112640861-112640883 GGGAAAATGCTGAAGGAGAAGGG - Intronic
1102554076 12:113714374-113714396 GAGAAAAGGCTCAGGGAGGAAGG + Intergenic
1103596769 12:122029022-122029044 GTGAAAAGGTGCAAGGAGGAGGG + Intronic
1105582489 13:21712237-21712259 GTTAAAATCCTTCAGGAAGAAGG + Intergenic
1107324855 13:39230667-39230689 GTGAAAATCCTTAAATGGGACGG - Intergenic
1111557701 13:89903328-89903350 GAGAAAGTCATAAAGGAGGAGGG - Intergenic
1111968033 13:94880920-94880942 ATGGAAATCATCAAGGAGGATGG - Intergenic
1112096710 13:96140995-96141017 AAGAAAATCATCAAGGAGAAAGG + Intronic
1112216818 13:97439371-97439393 GTGAAAATCCTGAATTAGCATGG + Intronic
1112797689 13:103074594-103074616 CTTAAAATCCTCAAGGAGACAGG - Intergenic
1113015334 13:105822654-105822676 GAGAAAATAATGAAGGAGGAAGG - Intergenic
1115675174 14:35665541-35665563 GTGGAAATCCTCTTGGAGGTTGG - Intronic
1116283416 14:42939951-42939973 TGGAAAATCCCCAAGGAAGAGGG - Intergenic
1117178992 14:53173446-53173468 GTGAAAATCTACAATCAGGAAGG - Intergenic
1117947677 14:61046677-61046699 GTAAAAATAATTAAGGAGGAAGG - Intronic
1119293050 14:73511080-73511102 GTTCAAATTCTCAAGTAGGAAGG + Intronic
1119915798 14:78400540-78400562 CTGAGAATCCTCAAGGGGGTTGG + Intronic
1121956645 14:98219532-98219554 GGGAATATCTTCAAGGAGAAGGG - Intergenic
1123409930 15:20049832-20049854 GTGAAAACCCTAAAGGGGTAGGG - Intergenic
1123519262 15:21056540-21056562 GTGAAAACCCTAAAGGGGTAGGG - Intergenic
1126510317 15:49464108-49464130 GTGATAAGCCTCATGAAGGATGG + Intronic
1126761817 15:51976646-51976668 TTTAAAATCCTGAAGGAGGCCGG + Intronic
1127735622 15:61835963-61835985 GTGAAACACATCAAGGAGGCAGG - Intergenic
1131301456 15:91203199-91203221 GGGGAAGTCCTCAAGGAGAAAGG - Intronic
1132135957 15:99338979-99339001 GTGACTATCAGCAAGGAGGAGGG + Intronic
1132500650 16:283275-283297 GAGGAAATCCCCAAGGAGGATGG + Exonic
1133713256 16:8421946-8421968 TTACAAATGCTCAAGGAGGAAGG - Intergenic
1137548223 16:49418593-49418615 GTGAAAAACCTCAGCCAGGAGGG - Intergenic
1138135536 16:54518070-54518092 GTGAAAATCATCAGGGATTAAGG - Intergenic
1138328208 16:56192293-56192315 GAGAAAAACCTCAAAGAGGATGG + Exonic
1140118729 16:72065257-72065279 GTGAAGAACCTCCAGGAGGTGGG + Intronic
1140202835 16:72908190-72908212 GTGTCAATCCCCAGGGAGGAGGG - Intronic
1143787094 17:9264003-9264025 GTGACTATCCTGAAGGAGCAAGG - Intronic
1143792988 17:9313236-9313258 GTCAAAATCCTCAAGGAACATGG + Intronic
1143827592 17:9624242-9624264 GTGAAAATTCTTAAGGAACAAGG - Intronic
1145002248 17:19313435-19313457 GCCACCATCCTCAAGGAGGAGGG - Intronic
1145122607 17:20274003-20274025 GTTAATATCCTTAAGGAGAAAGG - Intronic
1145375877 17:22347768-22347790 GTGAAAGTCCTTAATGAGAAAGG - Intergenic
1146233741 17:31137529-31137551 GAGGAAATCCTCAAGGAAAATGG - Intronic
1146588793 17:34109723-34109745 GAGCAAGTCCTCAATGAGGAAGG - Intronic
1149399488 17:56280424-56280446 GTGTAAATCCTGGAGGTGGAAGG - Intronic
1150144131 17:62753702-62753724 GTGAAAATCCTGAAGGACAGGGG - Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150296271 17:64009408-64009430 GTGCCCATCCTCAAGGAGTAAGG - Intronic
1151560840 17:74868778-74868800 GGTTAAATCCTCAGGGAGGAGGG - Intronic
1151915980 17:77118280-77118302 TTTGTAATCCTCAAGGAGGACGG - Intronic
1152141525 17:78540027-78540049 GTGCAAAGCCTCGAGTAGGAAGG - Intronic
1153613599 18:6912105-6912127 GTATAAATCCTCAAGCAGAATGG + Exonic
1155490628 18:26398053-26398075 GTGACAGCCCTCAGGGAGGAGGG - Intergenic
1155676623 18:28437365-28437387 TTCAAAAACATCAAGGAGGAGGG - Intergenic
1156439754 18:37172666-37172688 GTGAAAATGCCCAAGGAGGTGGG - Intronic
1157931177 18:51825396-51825418 GTGAAAATCATCTCGGTGGAGGG - Intergenic
1162455015 19:10778331-10778353 GTTAAAATCTTCCAGGAAGATGG - Intronic
1163174875 19:15557222-15557244 GTGCAAATCCTCTATCAGGAGGG - Intergenic
1164134978 19:22406291-22406313 GAGATAATACTCAAGGAGGCTGG - Intronic
1165151903 19:33765978-33766000 GTGAAGTTCCCCAAGTAGGAGGG + Intronic
1165313050 19:35040101-35040123 GTGCAAATCAGCAAGGAGGAGGG - Intronic
1165912732 19:39239037-39239059 GTTGAAAACCTAAAGGAGGAGGG + Intergenic
1168382003 19:55931970-55931992 GTGAGAGTCCTCAAGAAGGAAGG - Intronic
1168680891 19:58314999-58315021 GTGGATAACCTCAAGGAGCACGG - Exonic
925787038 2:7441927-7441949 GTAATAATCCTCATGTAGGAAGG + Intergenic
926489611 2:13507619-13507641 GTTAATATCCTCAAAGAGGTAGG - Intergenic
927463769 2:23321871-23321893 GTGAGGCTCCTCAAGGAGGCGGG + Intergenic
928116332 2:28547567-28547589 CTGAAAATCCTCATGGAGGTTGG + Intronic
930232854 2:48860275-48860297 TTGAAAATCCTCATCAAGGAGGG - Intergenic
930400161 2:50874192-50874214 GTGAAAATCCTAAATCAAGATGG - Intronic
930526231 2:52533803-52533825 TTGGAAATCCTCAATGATGATGG + Intergenic
931373746 2:61688866-61688888 TTGATAATGCTCCAGGAGGAGGG + Intergenic
932055088 2:68435158-68435180 GTGAAATGCTGCAAGGAGGAAGG - Intergenic
932701951 2:73998113-73998135 GTGAGAATCCTAGAGGTGGAAGG + Intronic
933476991 2:82803572-82803594 GTGAATGCCCTCAAGGAGGCAGG + Intergenic
933833546 2:86228812-86228834 GTGACACTCCTTGAGGAGGAAGG - Intronic
934745103 2:96754191-96754213 GTGGAATTCCTCTGGGAGGAAGG - Intergenic
935379792 2:102439990-102440012 AAGACAATCCTCAAAGAGGATGG + Intronic
935530374 2:104225310-104225332 GTAAGAACCCTCAAGGAAGAGGG + Intergenic
936279844 2:111128781-111128803 GACAAAATGCTCAAGGAAGAGGG - Intronic
937222236 2:120348373-120348395 TTCAAAATCCCCAAGGAGTAGGG - Intronic
937708236 2:124946640-124946662 GTGAACTTCCTCTAGGAGCAGGG + Intergenic
938734008 2:134169627-134169649 GTGAAAATCAGGAAGGAGAAAGG + Intronic
938997046 2:136691201-136691223 GTAAAAGTCCAAAAGGAGGAAGG + Intergenic
942547604 2:177080928-177080950 GTGAAATTCCTCCATGAGAAAGG - Intergenic
943104506 2:183527908-183527930 GAGAAGATCATCAAGAAGGAAGG + Intergenic
943540788 2:189211718-189211740 ATGAAAATACTCAGGGGGGAGGG + Intergenic
943718607 2:191179442-191179464 CTGAAACTCCTCAGGGATGAAGG - Intergenic
946313431 2:218895402-218895424 GTGAGAGTCCCCCAGGAGGAGGG + Intronic
946349163 2:219137194-219137216 ATGAAAATCTCCAGGGAGGAAGG - Intronic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
948065466 2:235075488-235075510 GTGGAAATCAGCAAGGAGGCAGG + Intergenic
948313687 2:237010318-237010340 GTGAAAATCCTGAAGTGTGAAGG + Intergenic
948497622 2:238362585-238362607 GTAAATATCCTGAAGGAGAAGGG - Intronic
1171430931 20:25082666-25082688 CTGAAAATCCCCAAGGGGAAAGG + Intergenic
1175019197 20:55826406-55826428 GTGGAAAGCCTCAAGGAGCTGGG - Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1181497357 22:23295093-23295115 ACGAAGATCCCCAAGGAGGACGG + Exonic
1182142912 22:27978047-27978069 CTGAAAATCACAAAGGAGGAAGG + Exonic
1182264095 22:29099080-29099102 GTGAAAATCCTCGCCCAGGATGG - Intronic
950155270 3:10717062-10717084 ATCAGAATCCTCAAGGAGGAGGG + Intergenic
950610390 3:14123241-14123263 CTGTAAATCCTCAAAGAGGAGGG + Intronic
951373940 3:21889609-21889631 GAGAAATTCCTCAGGGAGAAAGG + Intronic
952249506 3:31637680-31637702 GTGAAAGTCAACAAGGAAGAAGG - Intergenic
953356766 3:42263031-42263053 TTGGAAATCCTCTAGCAGGAAGG - Intronic
954855607 3:53641405-53641427 GTTCATATCCTCAAGGAGGATGG - Intronic
955315002 3:57931096-57931118 ATGAAAATCATAAAGGTGGAAGG - Intergenic
956551991 3:70471413-70471435 TTGAAAATCCTAAAAGAGAACGG + Intergenic
956790820 3:72678734-72678756 CTGATAATTCTCAATGAGGATGG + Intergenic
957178309 3:76841739-76841761 TTCTAAATCCTCAAGAAGGAAGG + Intronic
958411343 3:93820315-93820337 ATGGAAAGCTTCAAGGAGGAAGG - Intergenic
958769117 3:98405619-98405641 GTGCAAAAAATCAAGGAGGAGGG + Intergenic
958901317 3:99890116-99890138 GTAAAAATCCTCAAGAACGATGG - Intronic
964365331 3:155945062-155945084 GTGAAAATGCTCAAGCAGGCTGG + Intergenic
965186439 3:165471367-165471389 GTGAAAATTCTGAGGGAGGAAGG + Intergenic
965424620 3:168506592-168506614 GAGAAAATGGTTAAGGAGGAAGG - Intergenic
965595269 3:170404595-170404617 GTAAAAATCCTCAACAAGGCTGG - Intergenic
966926983 3:184651036-184651058 CTGAAGAACCTCAAGCAGGATGG + Intronic
967346401 3:188461172-188461194 TTGAAAATCCTCCAGTGGGAAGG - Intronic
967668956 3:192209316-192209338 ATGAAAATTATCAATGAGGATGG + Intronic
967857942 3:194132451-194132473 GTGAAAATCCTCTTGGTGAAAGG - Intergenic
969649580 4:8457062-8457084 AAGAAAATCATCAAGGAGAAAGG + Intronic
970760141 4:19475832-19475854 TTGAAAAACAGCAAGGAGGACGG + Intergenic
973221981 4:47737078-47737100 TTGGAACTACTCAAGGAGGAAGG + Intronic
974386915 4:61212793-61212815 TTGCAAATCCTCAAAGAAGAAGG + Intronic
977048186 4:92092811-92092833 GTAAAAATACTGAAGAAGGAGGG - Intergenic
977574294 4:98659644-98659666 ATGAAAGTGCTCCAGGAGGAGGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
981143772 4:141301662-141301684 TTGCAATTTCTCAAGGAGGACGG - Intergenic
981656795 4:147120793-147120815 GTGACACACCTCAAGGAGCAGGG + Intergenic
982941922 4:161569925-161569947 ATGAAAAACCTCAGGGAGGGAGG + Intronic
984966557 4:185144827-185144849 GTGAGAATCCCTAAGGAGCAGGG + Exonic
985974861 5:3409364-3409386 GCAAAAATCCTCAACGAGGCCGG - Intergenic
986257943 5:6116626-6116648 GTGAAGATACTGAAGGATGATGG + Intergenic
986778867 5:11045935-11045957 GTTAAAACCACCAAGGAGGAAGG - Intronic
988014885 5:25542674-25542696 GTGAAAATAGTGAAGTAGGAAGG - Intergenic
988669187 5:33362692-33362714 GTGAAACTACTAAGGGAGGAGGG + Intergenic
988711020 5:33774937-33774959 GTGAAAATCATCTAGGTAGACGG + Intronic
990155806 5:52876053-52876075 GTGAAAATCCTCAAGGAGGAAGG - Intronic
990781785 5:59372741-59372763 GTGAACATCTGCAAGGAGGCAGG + Intronic
992556820 5:77912051-77912073 GTAAATGTTCTCAAGGAGGATGG - Intergenic
999114547 5:149151198-149151220 GTGAAAAGACTCAGGGAGAAAGG - Intronic
1003393408 6:5732594-5732616 GTGGACATTCTCAATGAGGAGGG + Intronic
1003464557 6:6366103-6366125 GTTAAAATGTTTAAGGAGGATGG - Intergenic
1003550911 6:7101342-7101364 GTGAAAGGGCTCACGGAGGAGGG - Intergenic
1005703168 6:28424816-28424838 GTGAAAGTCATCCATGAGGATGG + Intergenic
1006309933 6:33250234-33250256 CTGAAAAACCTTCAGGAGGAAGG + Intergenic
1007869869 6:45022867-45022889 GTGAAACTCCTCTATAAGGAGGG - Intronic
1008111834 6:47503360-47503382 GTGAAAAAGCTACAGGAGGAAGG + Exonic
1010176276 6:73031827-73031849 GTAAATACCCTCAAGGAAGAAGG + Intronic
1011745169 6:90401795-90401817 GGGACAGTCCTCAATGAGGATGG - Intergenic
1015505755 6:133985785-133985807 TTGAAAGTCCCCAAGGAAGATGG - Intronic
1015596534 6:134872397-134872419 GGGAAAGACCTGAAGGAGGAAGG - Intergenic
1019920157 7:4158172-4158194 GTTGAAATCCTCAGGGAGAAAGG - Intronic
1021876325 7:25053022-25053044 GGGAAAATCCCCAAAAAGGAAGG - Intergenic
1021947302 7:25740624-25740646 GAGAAAATTCTCATGGAGGTGGG + Intergenic
1023286569 7:38627245-38627267 GTAAAAATGCTGAAGGAGGCCGG + Intronic
1024777616 7:52806248-52806270 ATAAAAATCCTCAAAGAGGCCGG + Intergenic
1024858561 7:53811599-53811621 GTGAAAATCCCGCAGAAGGACGG + Intergenic
1028354198 7:89886774-89886796 CTGGAAATCCTCAAGAAGGATGG - Intergenic
1028842674 7:95444854-95444876 GTGAAGCTCCTCAAGCAGAAAGG + Intergenic
1029163087 7:98566884-98566906 GTACAAATCCTCTAGGAGTAGGG - Intergenic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1032915293 7:136482866-136482888 AGAAAGATCCTCAAGGAGGAAGG - Intergenic
1033401507 7:141029796-141029818 GTGAAAAATCTCAAGGAAAAAGG - Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1034853521 7:154518657-154518679 GTGAAAATCCACAAGGCCTATGG - Intronic
1035076417 7:156180626-156180648 GTGAGCAGCCTCAGGGAGGAGGG + Intergenic
1036002093 8:4617813-4617835 ATGAATATACTCATGGAGGAGGG - Intronic
1037222418 8:16540245-16540267 GTGCAAATCATAAAGGAAGAAGG + Intronic
1038335436 8:26641849-26641871 GTGAAATTCCTGAGGCAGGAGGG + Intronic
1041809258 8:61889141-61889163 ATGAATATCCTCACAGAGGAGGG + Intergenic
1041828024 8:62120112-62120134 GTCAAGATCCTCAAGAAGAATGG + Intergenic
1042255741 8:66801775-66801797 GTGAAACTCTTCATAGAGGAAGG + Intronic
1042385791 8:68172721-68172743 GGGAAAATCCTAAAGGGGAAAGG + Intronic
1043117541 8:76277639-76277661 GTGATAATCCTCATGTTGGAAGG - Intergenic
1044009122 8:86970259-86970281 GTGAAATTCCAGAAGGAGTAGGG - Intronic
1045567355 8:103334145-103334167 GTCAAAATCCTCAAGAACAAGGG + Intergenic
1045713605 8:105015482-105015504 GGTAAAATCCTCAAGGAGAAAGG - Intronic
1045956529 8:107914640-107914662 TTGAAAATTCTAAAGGAGGAAGG - Intronic
1049019521 8:139946082-139946104 GTGGAAATCCCCAAGGGGGGAGG + Intronic
1050225430 9:3449305-3449327 CTGGAAATCCTCAAGAGGGATGG - Intronic
1052742020 9:32402605-32402627 GTGATAATACTCAAGGATTAGGG + Intronic
1055114521 9:72592515-72592537 GGGTAAATTCTGAAGGAGGAGGG - Intronic
1055602917 9:77938549-77938571 GTGAAAATGGGCAAGAAGGAAGG + Intronic
1056880383 9:90386315-90386337 GTGAAAGTTGTCAAAGAGGATGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059004505 9:110386491-110386513 TTGAACATCCTTCAGGAGGATGG + Intronic
1059958895 9:119545991-119546013 GAAAAGACCCTCAAGGAGGAAGG + Intergenic
1060446351 9:123691802-123691824 GTGAAAGTCCTCAAGGAAGAAGG + Intronic
1061758437 9:132832863-132832885 GTGAAAATCTAAAAGGAAGAAGG + Intronic
1186637346 X:11420716-11420738 GTCATTATCCTCAAGGAGTAGGG + Intronic
1187973746 X:24684349-24684371 GTGAAAATCTTGAAGGAAGTTGG + Intergenic
1188353096 X:29156450-29156472 ATGACTATTCTCAAGGAGGAAGG - Intronic
1189957276 X:46288548-46288570 ATGAAGATCCTCAAGGAGGGCGG - Intergenic
1191722446 X:64244947-64244969 GTTAAAATCCCCAAGGAAGTAGG - Intergenic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1194024262 X:88732187-88732209 TTGTAAAACCTCAAGGAGAAGGG - Intergenic
1194381683 X:93199992-93200014 TTAAAAATCTTCAAGGAGCAGGG - Intergenic
1195115156 X:101690103-101690125 CTGAAAAGTCTCAAGAAGGAAGG - Intergenic
1196140771 X:112260977-112260999 TTGTAAATCCTCAAGGATGAGGG - Intergenic
1197116402 X:122838723-122838745 GTGAAAATCATCCGTGAGGAAGG - Intergenic
1197720662 X:129742461-129742483 GGGAAACCCCTCTAGGAGGAGGG + Intronic
1198253013 X:134900055-134900077 GTTAAAATCCTCAATGTGAAAGG - Intronic