ID: 990159373

View in Genome Browser
Species Human (GRCh38)
Location 5:52920494-52920516
Sequence TGTATTCTTGATTTGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990159373 Original CRISPR TGTATTCTTGATTTGGAATA AGG (reversed) Intronic
901140850 1:7028971-7028993 AGTGTTATTGATTTGGAATGAGG + Intronic
905743896 1:40396713-40396735 TTTATTGTTATTTTGGAATAAGG + Intronic
909058950 1:70856712-70856734 TGGATTCATAATTTGGAAAATGG + Intronic
909232804 1:73113347-73113369 TGTATCCTTGATTTTTAACAAGG - Intergenic
909458382 1:75876739-75876761 TGTACTCTTTATTTGGAAAAAGG + Intronic
909813215 1:79958030-79958052 TTTATTATTGATTTGATATATGG - Intergenic
910329923 1:86060069-86060091 TGTATTCTTGATTTAAAACAAGG + Intronic
910360366 1:86409729-86409751 TGTATTGTTGTTGTGGAATATGG - Intergenic
911340300 1:96628092-96628114 TGTAATTAGGATTTGGAATAGGG - Intergenic
911355548 1:96814273-96814295 TGTAATTAAGATTTGGAATATGG + Exonic
911372169 1:97006807-97006829 AATATTCTTTATTTGGAATCCGG + Intergenic
911626950 1:100134568-100134590 GACATTCTTGTTTTGGAATATGG + Intronic
911763620 1:101645654-101645676 TGTTTTCTTGAGTTTGAAGAAGG + Intergenic
912749938 1:112278825-112278847 TGCATTGATGATTTGGAAAATGG + Intergenic
913484408 1:119320496-119320518 TATTTTCTTCATTTGGAAAATGG + Intergenic
914883409 1:151565352-151565374 TGTATCCTTGATTTGCATTTTGG + Intronic
915825838 1:159076043-159076065 TGTATTCCTTATTTTGAAAATGG - Intronic
916374958 1:164143069-164143091 AGTATTCTTGATGTTAAATATGG - Intergenic
917015069 1:170521205-170521227 TGTGTTCTGGCTTTGGGATATGG - Intergenic
917136775 1:171795689-171795711 GGTATTTTTGATTTGGTGTAAGG + Intronic
917219363 1:172711352-172711374 TGAATTCGTGATCAGGAATAAGG - Intergenic
917970804 1:180206183-180206205 TGTGCTGTTGATTTGGAAGAGGG + Intergenic
918065359 1:181097050-181097072 TTTATTTTTGGTTTGGAAAAGGG + Intergenic
918642380 1:186858722-186858744 TTTATTCATGTTTTGTAATATGG - Intronic
919488471 1:198173640-198173662 AGCATTCTTTAGTTGGAATATGG + Intronic
919845229 1:201638161-201638183 TGTCTTCTTGATTTGCTATGTGG - Intronic
919969198 1:202562193-202562215 AGCAGTCTTGATGTGGAATATGG + Intronic
920449648 1:206049999-206050021 TGTATTTTGGATTTGTAAAAAGG + Intronic
921443415 1:215215758-215215780 TGACTTCTGAATTTGGAATATGG - Intronic
921445388 1:215240854-215240876 TTGATTCTTGATTTTGTATATGG + Intergenic
924748868 1:246865966-246865988 TGCATTCTTTATATGGATTATGG - Intronic
1063163909 10:3442573-3442595 TGTTTTCGTGATTATGAATAAGG + Intergenic
1064790841 10:18956411-18956433 TGTATTCTTTAATTGGTATATGG + Intergenic
1066484111 10:35826957-35826979 TGTAGTCTTCAAGTGGAATATGG + Intergenic
1067223519 10:44360916-44360938 TGCATTCTGGAATTGGAAAAAGG - Intergenic
1067548582 10:47215909-47215931 TGTATTCTGAATTAGGAATGAGG - Intergenic
1068339425 10:55682900-55682922 TTTCTTCATGATTTGGAAGAAGG - Intergenic
1068375813 10:56178832-56178854 TTTATTCTTTTTTTGGAAAATGG + Intergenic
1068625079 10:59236085-59236107 AGTTTTCTTGATTTCTAATATGG - Intronic
1068896234 10:62205413-62205435 TGTTTTATTAATTTGAAATATGG - Intronic
1071418828 10:85468207-85468229 TGCATTCTTGATTTGGCTTTTGG - Intergenic
1073568222 10:104553863-104553885 TGTATTCTTCATTTGGATTGTGG + Intergenic
1074605696 10:114962798-114962820 TGTATTTTTGGTGTGGTATACGG + Intronic
1075761580 10:124861359-124861381 TGTATTGTTGATTTTTAAAAGGG - Intergenic
1077739543 11:4830202-4830224 TCCATTCTTGGTCTGGAATAAGG + Intronic
1078117165 11:8465414-8465436 TGGATTCTTGGTTTGGATGATGG - Intronic
1078729419 11:13962313-13962335 TGTAATCTTTATTGGGAGTAGGG + Intergenic
1079347426 11:19665149-19665171 TGTTCTCTTGATTTGGCATCAGG - Intronic
1079547453 11:21650694-21650716 TGTATTCTTAATTTTGCATATGG + Intergenic
1082309246 11:50626370-50626392 TGAATTGTTGATTTGCAGTATGG - Intergenic
1083491628 11:63018419-63018441 TGCATTTTTAATTTGGGATATGG + Intergenic
1085959610 11:81445470-81445492 TGTTTTCTTGTTTTGCAAAAAGG + Intergenic
1086469323 11:87089782-87089804 AGTATTTTTGATTTAGAATTTGG + Intronic
1086820961 11:91435588-91435610 TGTACTTTTTATTTGAAATACGG - Intergenic
1086893832 11:92289654-92289676 TGTCTTCTTGACTTGGACCAAGG - Intergenic
1086962347 11:92991233-92991255 TGTATACTTAATTTGCAATTAGG - Intergenic
1086962378 11:92991674-92991696 TGTATACTTAATTTGCAATTAGG - Intergenic
1087421630 11:97934020-97934042 TGTCTTATTAATTTGGCATACGG - Intergenic
1087936568 11:104040267-104040289 TGTTTTTAGGATTTGGAATATGG - Intronic
1089926619 11:122264841-122264863 TGTTTTCTTGATATGGACAAGGG - Intergenic
1090300157 11:125628989-125629011 TGCATTCTTGATTTGGATATTGG + Intronic
1091016366 11:132054640-132054662 TGTATTCTATATTTACAATATGG - Intronic
1091144200 11:133263003-133263025 TGCATTATTGGTTTGGGATAAGG - Intronic
1092031744 12:5292223-5292245 TGTAATGTTGATTTGGAGTCAGG + Intergenic
1092962364 12:13608465-13608487 TGTTTTCTTGTATTGGAACATGG - Intronic
1092962882 12:13612901-13612923 TTTATTAATGATTTGGAAGATGG - Intronic
1092993998 12:13930663-13930685 TTTATTCATGATTTGGATAAAGG + Intronic
1095190115 12:39248021-39248043 TGTTATCTTAATTAGGAATATGG + Intergenic
1095359004 12:41313090-41313112 TGTATTTCTGGTTTGGAAGATGG - Intronic
1096607088 12:52774722-52774744 TGTGTGGTTGAATTGGAATAGGG + Intronic
1098584466 12:72139734-72139756 TTTATTTTTGATTTACAATAGGG - Intronic
1101926341 12:108974722-108974744 TGTATTTTTTTTTTGAAATAGGG - Intronic
1102715377 12:114967157-114967179 TGTTTTCTTGATTGCAAATAGGG - Intergenic
1107112712 13:36715171-36715193 TGTCTTCTAGATCTAGAATAGGG + Intergenic
1108227784 13:48306396-48306418 TTTTTTCTTGTTTTGAAATAGGG - Intronic
1108251868 13:48575698-48575720 TATATTCTGGATTTGAAGTATGG + Intergenic
1109523941 13:63550169-63550191 TGTGTTCCTGATTTTGAAAAAGG - Intergenic
1110944350 13:81394305-81394327 TGTGTGATTTATTTGGAATATGG - Intergenic
1111123943 13:83888799-83888821 TGTATTCCTGTTTTTGAAAAAGG + Intergenic
1112055545 13:95687149-95687171 TGAATTCTTGATTTGGTTTTTGG + Intronic
1112657800 13:101470809-101470831 CTTATTCTTAATTTGAAATAAGG + Intronic
1112861852 13:103838675-103838697 TATATTCTTGATTTTTAAAATGG - Intergenic
1114783933 14:25572109-25572131 TGATTTCTTGATTTGGGATGAGG - Intergenic
1114783948 14:25572281-25572303 TTTGTTCTTTATTTGAAATAGGG - Intergenic
1116071881 14:40057570-40057592 TGAATTCTTCATTTGGATTAAGG + Intergenic
1116434631 14:44882875-44882897 TGAACTCTTGATTTGCAATTTGG - Intergenic
1116503168 14:45645807-45645829 TTTATTTTTGATTTGGGGTAAGG + Intergenic
1116617814 14:47160996-47161018 AATACTCCTGATTTGGAATAAGG - Intronic
1116742816 14:48777781-48777803 TGTATTATTCATGTGAAATATGG - Intergenic
1117036969 14:51740017-51740039 TCTATTCTGGATTTTGAATTAGG - Intergenic
1117218299 14:53575028-53575050 AGTATTTTTGATTTGGTTTAAGG - Intergenic
1119391428 14:74293785-74293807 TGCATTCTTCACTTGGAATCAGG + Intronic
1121200765 14:92115576-92115598 TGTATCCTACATTTGGAAAAAGG + Intergenic
1122701014 14:103589208-103589230 TGTATTAGTGAAATGGAATATGG + Intronic
1125002061 15:34781907-34781929 TGTATTCTTGATTTGGCTCTTGG + Intergenic
1125347006 15:38728517-38728539 TGTATTCTGGCTTTGGAAGTGGG + Intergenic
1125713794 15:41807436-41807458 GTTTTTCTGGATTTGGAATATGG + Intronic
1126961868 15:54005444-54005466 CGTATTCTTCATTTGTAAAATGG + Intergenic
1127539825 15:59926224-59926246 TAAATTGTTGAGTTGGAATAGGG - Intergenic
1127653855 15:61036820-61036842 TGTTTTCTTGTTTTGGGAGAAGG - Intronic
1127803842 15:62500472-62500494 TGTCTTCTTGTTTTGCAGTATGG - Intronic
1129224383 15:74158765-74158787 AGTATTTTTTATTTGGAAAATGG + Intergenic
1129991612 15:79969117-79969139 TGTTTTCTTGATTTCTAGTAAGG - Intronic
1130545164 15:84851709-84851731 TGTTTTATTTATTTGGAATATGG + Intronic
1130907403 15:88250332-88250354 TGTTTTCTTGATCTGTAAAATGG + Intronic
1131384922 15:91997216-91997238 TGCATTCTTGATTTGGCTTTTGG - Intronic
1131407761 15:92180328-92180350 TATATTTTTGATGTGGAATTTGG - Intergenic
1131849955 15:96528418-96528440 TGTATTCTTGAGTACGAATGTGG + Intergenic
1132170446 15:99647168-99647190 TGTATTCATGACATGTAATAGGG - Intronic
1132416147 15:101620288-101620310 TGCATTCTTTAGTTGGCATAAGG + Intergenic
1133089528 16:3393127-3393149 TGTAATCTTGCTTTTGGATATGG + Intronic
1135508075 16:23056561-23056583 TGTATTCTTAATTTTGGTTATGG - Intergenic
1135782568 16:25317503-25317525 TGTTGTTTTAATTTGGAATAAGG - Intergenic
1137525814 16:49235318-49235340 TGTTTTCTTTATTTGTAATATGG + Intergenic
1137768890 16:50999090-50999112 TGTATTAATGACTTGGAAAATGG + Intergenic
1138869012 16:60858350-60858372 TGAACCCTTGATTTGGAAAATGG + Intergenic
1140526524 16:75627508-75627530 TGTATTCTTTCTTTGGGGTAGGG - Exonic
1140559990 16:75968195-75968217 TTTCTACTTGGTTTGGAATATGG + Intergenic
1140721893 16:77779673-77779695 TGCATTCTTGATATGCACTAAGG - Intergenic
1140937559 16:79688451-79688473 TGACTTGTTTATTTGGAATATGG + Intergenic
1152008437 17:77696455-77696477 TGTATTCTTTGTTTGAAATACGG - Intergenic
1152850239 17:82629628-82629650 TTTATTTTTGTTTTGGAATTAGG - Intronic
1153064007 18:1024208-1024230 TGTATTCTTCACATGGTATATGG + Intergenic
1155283928 18:24269720-24269742 TGCATTCTATATTGGGAATATGG + Intronic
1155297243 18:24396833-24396855 TGCATTCTGGATTTGGAGTTTGG - Intronic
1155611219 18:27669607-27669629 TGTATTCTTTACTTGGACTTTGG - Intergenic
1156624712 18:38894581-38894603 TGAATTCTTTTTTTGGAGTAAGG + Intergenic
1156721155 18:40071377-40071399 TGTATACATAATTTGGAACAGGG + Intergenic
1157015120 18:43703116-43703138 TGCATTCATCATTTGGCATATGG + Intergenic
1158105011 18:53875711-53875733 TCTATTCTTGATTAGGAAGGTGG - Intergenic
1159459285 18:68703193-68703215 TGTCTTCTTAATTTGGAAAGGGG - Intronic
1163781478 19:19251577-19251599 TGACTTCTGGATTTGGAGTAAGG - Exonic
1164821251 19:31252810-31252832 TGTTTACTTTATTTGGAAAAAGG - Intergenic
1165366480 19:35370625-35370647 TGTGTTCATGCTTTGAAATATGG + Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1168504812 19:56924559-56924581 TGAATTCCTAAATTGGAATATGG - Intergenic
926761557 2:16282909-16282931 TGCATTCATAATTTGGAATCTGG - Intergenic
926824033 2:16884380-16884402 TGTATTCTTTATCTGTAAGAAGG - Intergenic
927487847 2:23501282-23501304 CCTATTCCTGCTTTGGAATAGGG + Intronic
928776921 2:34776998-34777020 TGAATCATTAATTTGGAATATGG - Intergenic
928790467 2:34945525-34945547 GTTATGCTTGATTTGGAATGTGG - Intergenic
928923042 2:36545802-36545824 TTTCTATTTGATTTGGAATATGG + Intronic
929380060 2:41338624-41338646 TGTGTTCCTGATATGGCATAGGG - Intergenic
935508986 2:103947452-103947474 TGTTTACTTCATTTGCAATACGG - Intergenic
935550819 2:104451695-104451717 TGCATTTTTGATTTGCAAAATGG - Intergenic
939454188 2:142411662-142411684 TGCATTCTTGATTTAAAATATGG - Intergenic
940122185 2:150279028-150279050 GGCATCCTTTATTTGGAATATGG - Intergenic
940752508 2:157642408-157642430 TGTATTCTTTATTATGCATAAGG + Intergenic
942963474 2:181861230-181861252 TGGAATCTTGGTTTGAAATAGGG + Intergenic
943251512 2:185526454-185526476 TTTATTCTGGATATGGAATATGG + Intergenic
943466329 2:188233708-188233730 TGAATTGTTGAATTGGGATAGGG + Intergenic
943722330 2:191218143-191218165 TGTTTTCTTTATTTGTAAAATGG - Intergenic
943743127 2:191432739-191432761 TGCCATCTTGATTTAGAATATGG + Intergenic
944274632 2:197821868-197821890 TATATTCTTAATTTGGAGAAGGG + Intronic
1169479585 20:5966730-5966752 TGTGTTTTTGAATTGGAATTGGG + Intronic
1170280818 20:14646742-14646764 TGAATTAATGATTTGAAATATGG - Intronic
1170346336 20:15390939-15390961 TGCATTGTTCATTTGGAAGATGG + Intronic
1171514959 20:25722674-25722696 TGTTTTCTTGATTTGGCCTTTGG + Intergenic
1172443540 20:34981247-34981269 TGTGTTCTTGATGGGGGATAGGG + Intronic
1174021808 20:47536232-47536254 TGTAGTCTTGATATGGGAGAAGG - Intronic
1174582525 20:51582178-51582200 TGTGCTCTGGATTAGGAATAAGG - Intergenic
1177137144 21:17317490-17317512 TGTATTTTGGCTTTGGTATAAGG - Intergenic
1177924303 21:27194691-27194713 ACCATTCTTGTTTTGGAATAGGG + Intergenic
1178995939 21:37399816-37399838 TGTATTCTTAATTTGCATTCTGG - Intronic
1179135379 21:38675879-38675901 TGTATTCTCAATTTGGCAAATGG + Intergenic
1181539104 22:23563900-23563922 TCTATTCTTGATTTGGAGATGGG - Intergenic
949323333 3:2836694-2836716 TGTATTTTTAATCTGTAATATGG - Intronic
949526536 3:4910295-4910317 TGTGGTCTTGTTTTGGAAGAGGG - Intergenic
949989453 3:9566524-9566546 TGTATTATTCATTTGGGATTGGG + Intergenic
951652014 3:24961297-24961319 TTTATTCTTGGTCTGGAAAAAGG - Intergenic
952583339 3:34861792-34861814 TGTATTCTTCATTAAGTATAAGG + Intergenic
953511750 3:43548262-43548284 TGCTTTCTTGATTTAGAATATGG - Intronic
954525648 3:51268383-51268405 TGAATTCTTGATTTGTTCTAGGG - Intronic
955640166 3:61073958-61073980 TTTATTCTTGATTTGGCATTGGG + Intronic
958002360 3:87766721-87766743 GTTATTCTTGCCTTGGAATAGGG - Intergenic
959139189 3:102464498-102464520 TTTATTCATGTTTAGGAATATGG + Intronic
959598976 3:108157798-108157820 TATAATCTTGACTTGAAATATGG + Intergenic
959636354 3:108576858-108576880 TGTATCCTAGATTTGGGAGATGG + Intronic
960163849 3:114379904-114379926 TTTATTCTTGATCTGGATAATGG - Intronic
960256444 3:115516280-115516302 TGTGTGCTGGATTTGGGATATGG - Intergenic
961968280 3:130928977-130928999 TGTTTTATAGATTTGAAATAAGG + Intronic
964138974 3:153376587-153376609 TACATTCTGGATTTGGAAAATGG + Intergenic
964706485 3:159624223-159624245 CATGTTCTTGATCTGGAATATGG - Intronic
966021013 3:175210568-175210590 TATATTGTTAATGTGGAATATGG + Intronic
967025168 3:185558366-185558388 GGTATTCTTGAGTTGTAATCAGG - Intergenic
969382894 4:6818092-6818114 TGTATTCTTGATTTGGTTCTTGG - Intronic
970291552 4:14578465-14578487 TTTATTCTTTATCTGGAGTATGG + Intergenic
972132094 4:35850517-35850539 AGCATCCTTGATTTAGAATAAGG - Intergenic
972671831 4:41219893-41219915 TATATTTTTGAAATGGAATAAGG - Intergenic
973025932 4:45271011-45271033 TCTTTTCTTGTTTTGGTATAAGG - Intergenic
973659460 4:53088111-53088133 TGTTATCTTGTTTTGCAATATGG - Intronic
974879781 4:67740952-67740974 AGTAATCTGGATTTGAAATATGG + Intronic
976034774 4:80803642-80803664 TTTATTCTTCTTTTTGAATATGG - Intronic
976712396 4:88086351-88086373 TGTATTTTTGACTTACAATATGG + Intergenic
976767359 4:88611061-88611083 TGTGATCTAAATTTGGAATAAGG + Intronic
977299842 4:95255288-95255310 TGTGTTCTTGAGGTGGAACATGG + Intronic
977477083 4:97525871-97525893 TGTCTTCTTTTTTTGGAACATGG + Intronic
978037507 4:104013840-104013862 GATGTTCTTGCTTTGGAATAAGG + Intergenic
978653827 4:111042571-111042593 TGTATTCTTTCTTTGGAGTTTGG - Intergenic
978718937 4:111882273-111882295 TGTATACTTAATAGGGAATAAGG + Intergenic
979586371 4:122423175-122423197 GGTATACTTGATTTGGGACAGGG + Intronic
981202186 4:141993298-141993320 TATATTATACATTTGGAATATGG + Intergenic
981210068 4:142092804-142092826 TGTACTGTTGATTTAGAATGAGG + Intronic
982496605 4:156102444-156102466 TCTATCCTTGATCTGGACTAAGG + Intergenic
984018116 4:174450238-174450260 TTTATTCTTGCACTGGAATATGG - Intergenic
984230945 4:177097793-177097815 TGACTTGTTGATTTGGGATATGG + Intergenic
985345289 4:188998448-188998470 TTTATTCATGATTTGGCATGCGG + Intergenic
985346928 4:189016033-189016055 TGTATTCAGCATTTGTAATATGG - Intergenic
986388400 5:7262185-7262207 TGTATACTTGAATTAAAATATGG - Intergenic
988293614 5:29324821-29324843 TGTAATCTTAATTTGAAAGAGGG + Intergenic
989076681 5:37571116-37571138 TGAAAGCTTGATTTTGAATATGG + Intronic
990159373 5:52920494-52920516 TGTATTCTTGATTTGGAATAAGG - Intronic
990811051 5:59724030-59724052 TTTATTCTTGACTTGGAAAAAGG + Intronic
991633989 5:68684677-68684699 TGCATTCTTGACATGGGATAAGG + Intergenic
992365724 5:76087401-76087423 TGTACTCTTGACTTGTAAGAGGG - Intronic
993254142 5:85565936-85565958 AGTATTCTGAATTTGAAATATGG - Intergenic
994795682 5:104296340-104296362 TTTATACTTGATTTGCAAGAGGG + Intergenic
994902965 5:105800498-105800520 TGTATTCCTGATTAGAAATTTGG + Intergenic
994959255 5:106577886-106577908 TGTCTTCTTTAAATGGAATATGG + Intergenic
995301210 5:110585542-110585564 TCTATTCAAGATTTGGAAAATGG + Intronic
995639819 5:114242830-114242852 TGTTTTATTAATTTGTAATAGGG - Intergenic
995768356 5:115643347-115643369 TGTATTCTTGCATTGGTCTATGG - Intergenic
996063699 5:119058728-119058750 TGTATTATTCATTGGGAAAAAGG - Intronic
998480109 5:142455995-142456017 AATATGCTTGATTTGGAAAAGGG + Intergenic
999075560 5:148792151-148792173 GGTCTTCTTCATTTGTAATATGG + Intergenic
1000040010 5:157478502-157478524 TGCAATCGTGCTTTGGAATAAGG + Exonic
1000649492 5:163798824-163798846 TGTATTGAGGATTTTGAATAAGG - Intergenic
1001130673 5:169061034-169061056 TATATTCATGCTTTGCAATAAGG - Intronic
1001656196 5:173352372-173352394 GGTACTCTTGATGTGGAATAAGG + Intergenic
1002797254 6:484073-484095 TTTATTCTGGATTTGGTACAAGG - Intergenic
1005100059 6:22162009-22162031 TGTATTCTAGAGTTCTAATATGG - Intergenic
1005593794 6:27357675-27357697 TCTTTTCTTGATTAAGAATATGG - Intergenic
1011350848 6:86422101-86422123 TGGATTCTTCATTTGCAAAATGG + Intergenic
1012014913 6:93837946-93837968 TTTATTTTTGATTTTGAATGGGG - Intergenic
1012416551 6:99019711-99019733 TGTATTGTTGTTTTGGGTTATGG - Intergenic
1014561336 6:122894478-122894500 TGTATACTTTCTTTTGAATAGGG - Intergenic
1014994877 6:128130325-128130347 CGTATTCTTGATTTGAAGAAAGG - Intronic
1016403508 6:143705714-143705736 TGTACTCTTGATATGATATAAGG - Intronic
1016652629 6:146480370-146480392 TGTATTCTTGATTTGGTTCTTGG + Intergenic
1017279037 6:152603658-152603680 TGTATTCTAGATATAGAATAGGG - Intronic
1019191403 6:170253142-170253164 TTTCTTCTAGATTTGCAATAAGG - Intergenic
1020700931 7:11482289-11482311 TGTACTCTTAAGTTGTAATAAGG + Intronic
1020916513 7:14200500-14200522 TTTCTTCTTGATTAGGAATTTGG + Intronic
1020950643 7:14671765-14671787 TATATTCTTATTTTGAAATATGG - Intronic
1020967194 7:14886083-14886105 TGTATTCTTAACTTGCTATATGG - Intronic
1021216134 7:17917512-17917534 TGTGTTCTTGATTTGGTTTTTGG - Intronic
1022052227 7:26687594-26687616 TGAATTCTTGATATGAAATCTGG + Intronic
1023222685 7:37935644-37935666 AGTTTTCTTAATTTGGCATAAGG - Intronic
1025152203 7:56566916-56566938 TGTATGTTTGATTTGAGATAGGG - Intergenic
1029923269 7:104288652-104288674 TATAGTCTTTATTTGTAATAGGG - Intergenic
1030337845 7:108344859-108344881 TGTATTTTTGTTTGGAAATAAGG - Intronic
1030755947 7:113288164-113288186 TGTATTTTTTATTTGTATTATGG - Intergenic
1030838180 7:114314151-114314173 TTTTTTCTTGCTATGGAATATGG + Intronic
1031886412 7:127250509-127250531 AGAATTCTTGCTTTTGAATAAGG - Intronic
1031987265 7:128171263-128171285 TGGAGTCCTGATTTGGAATCAGG - Intergenic
1032242819 7:130178420-130178442 AGTATTCCTGATTTGGAGTAAGG + Exonic
1033880335 7:145874068-145874090 AGTATTCTTCATGTGGAAAATGG - Intergenic
1033992308 7:147303623-147303645 TGCATACCTGATTTTGAATATGG + Intronic
1034615166 7:152410039-152410061 TATATTCTGGATTTGGAAGTTGG - Intronic
1034827109 7:154275516-154275538 TGTCTTCTCAATTTGGAACAAGG - Intronic
1034843143 7:154418218-154418240 GGTTTTCCTGATTTGGAACAGGG - Intronic
1035241461 7:157533254-157533276 TGCATTCTTGATTTGGCTCATGG + Intergenic
1035853809 8:2950583-2950605 TTTATTCTTTCTGTGGAATAAGG - Intronic
1039162817 8:34641355-34641377 TGTTTTCTTGTTTTGGAATCAGG + Intergenic
1039413021 8:37371457-37371479 TGTCTTCTTGTTTTGTGATATGG - Intergenic
1040629524 8:49194187-49194209 TGATTTCTTAATTTGAAATATGG + Intergenic
1040820969 8:51556661-51556683 TGTATGATTGAGTTGGCATAAGG - Intronic
1041595343 8:59644182-59644204 AGTATTTTTGATTTGAAACAAGG - Intergenic
1042811542 8:72830870-72830892 TTTAATCTTCATTTGGAATGAGG + Intronic
1043710278 8:83407863-83407885 GGAATTCCTGATTTGGAAAAGGG - Intergenic
1043851663 8:85223197-85223219 TGTATGGTTCATTTGGAACATGG - Intronic
1045452785 8:102345138-102345160 TGTATTTTTAATTAGGAATATGG - Intronic
1046295111 8:112208820-112208842 GGTATTCTTGATGAAGAATAGGG + Intergenic
1046615834 8:116476420-116476442 TGTATTCTATTTTTCGAATATGG - Intergenic
1047656857 8:126986790-126986812 TGTTTTCTTGATTTGTTTTACGG + Intergenic
1047668919 8:127123449-127123471 TGTGTTCTAGATTGGGAAGACGG - Intergenic
1048456420 8:134582576-134582598 TGTATTTTTAATTTTGATTATGG + Intronic
1050092564 9:2029779-2029801 TTTATTCTGGTTTTGGAAGAAGG + Intronic
1051145028 9:14018129-14018151 TGTATTCTTAATTTGGTGTTTGG - Intergenic
1051500070 9:17766896-17766918 TGGATTCTTGATTTAGAATTAGG + Intronic
1051642134 9:19233151-19233173 TGTTTTTTTGATTTGCAAAACGG + Intronic
1051915547 9:22202630-22202652 TGTTTTCTTGCTGTGGAAAAGGG - Intergenic
1052717460 9:32134243-32134265 TATTTTCTTGATTTGGAAATGGG + Intergenic
1053235583 9:36450997-36451019 AGTATACTTTATTTGGAATTGGG - Intronic
1055281936 9:74684289-74684311 TGGATTCTTGTTATTGAATAGGG + Intronic
1055404945 9:75964813-75964835 CAAATTGTTGATTTGGAATATGG - Intronic
1055616931 9:78082767-78082789 TTTATTCTTTATTAGTAATATGG + Intergenic
1055735398 9:79323647-79323669 TGTGTTCTGTATTGGGAATATGG + Intergenic
1055835259 9:80432418-80432440 TGTATTTTTTATTTGGATAATGG - Intergenic
1056101811 9:83306984-83307006 TGTATTCATGATTTGTATTTAGG - Intronic
1057335440 9:94151490-94151512 TTTATTCTTGATTTGTAACGTGG + Intergenic
1058160253 9:101562767-101562789 GGTATTTTTGATGTGGAAAAGGG + Exonic
1058493842 9:105532984-105533006 TGTATTCTTGCTTTGCCATCAGG + Intronic
1186021379 X:5260154-5260176 TGTCTGTTTTATTTGGAATATGG + Intergenic
1187292630 X:17969829-17969851 TTTAGGCTTGATTTGGGATATGG - Intergenic
1187298814 X:18028374-18028396 AGTATTCTTGATTGGTAACATGG - Intergenic
1187866106 X:23724763-23724785 TGTTTTGTTTTTTTGGAATAGGG - Intronic
1188059929 X:25589444-25589466 TGAATTCTTTATCTGGAATTTGG + Intergenic
1188813748 X:34685560-34685582 TGTATTTTTGTTTTTGAGTAGGG + Intergenic
1189027942 X:37417899-37417921 TTTATTATTGGTTTGGGATATGG + Intronic
1189548666 X:42070721-42070743 TGTGTTCTTGTTTTAAAATAAGG + Intergenic
1189564523 X:42227743-42227765 TAAATTCTTCATTTGGAATTTGG + Intergenic
1189767448 X:44386140-44386162 TGTATTCTTGAAGTGGAGCAGGG - Intergenic
1191708408 X:64118689-64118711 TGCATTCTTGATTTGGATCTTGG + Intergenic
1194241137 X:91450530-91450552 TATTTTCTTGATCTTGAATATGG - Intergenic
1194824921 X:98550125-98550147 TGCATTCCTGATTTGGGATTTGG + Intergenic
1195483448 X:105374614-105374636 TGTATTCCTGATTTGGCTTTTGG + Intronic
1198025060 X:132696931-132696953 TGAATTCTTGATTTGCCATGGGG - Intronic
1201324896 Y:12745664-12745686 AGTATTCTTGACTTATAATATGG - Intronic
1201400734 Y:13601248-13601270 TGTATTCTTGACTTGGCTTGTGG - Intergenic
1201564456 Y:15351609-15351631 TGTTTTCTTGAGATGGAATCTGG - Intergenic
1202269013 Y:23052655-23052677 TGAATATTTGATGTGGAATAAGG + Intergenic
1202422005 Y:24686395-24686417 TGAATATTTGATGTGGAATAAGG + Intergenic
1202448781 Y:24983683-24983705 TGAATATTTGATGTGGAATAAGG - Intergenic