ID: 990159604

View in Genome Browser
Species Human (GRCh38)
Location 5:52923112-52923134
Sequence AAGGAGTTAGATGTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 3, 1: 0, 2: 3, 3: 39, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990159594_990159604 12 Left 990159594 5:52923077-52923099 CCTTCTCTTCAAGCTGTGAAAAC 0: 1
1: 0
2: 1
3: 27
4: 329
Right 990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG 0: 3
1: 0
2: 3
3: 39
4: 307
990159599_990159604 -10 Left 990159599 5:52923099-52923121 CCTGGGGAATTTTAAGGAGTTAG 0: 2
1: 1
2: 0
3: 13
4: 125
Right 990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG 0: 3
1: 0
2: 3
3: 39
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990159604 Original CRISPR AAGGAGTTAGATGTGGGGCA GGG Intronic
903033606 1:20480531-20480553 AAGGGTTTAGAAGGGGGGCAGGG - Intergenic
903706158 1:25287402-25287424 AAGCAGTCAGGGGTGGGGCAGGG - Intronic
904014405 1:27408882-27408904 AAGGAGTTAGAAAGAGGGCAGGG + Intronic
904274537 1:29371712-29371734 AATGAGTTAGCAGTGGGCCAGGG + Intergenic
904459867 1:30669975-30669997 AAGGAGTTAGATATTGGGAGAGG + Intergenic
904973692 1:34439201-34439223 AAAGAATTAGACATGGGGCAAGG - Intergenic
907033120 1:51192052-51192074 TAGGAGTTAGATGGGGGTGATGG - Intergenic
907218255 1:52884706-52884728 AAGGAGAGAGTTGAGGGGCAGGG + Intronic
907375918 1:54039835-54039857 GAGGAGTAAAATGTGGGGGAGGG + Intronic
907856738 1:58311112-58311134 AAGGACTTAGATGTAGGGTGGGG - Intronic
907891283 1:58638880-58638902 CAGGAGTTAGCTGGGGGGCTGGG - Intergenic
908916778 1:69136985-69137007 AAGGAAGTAGATGTAGGGAAAGG + Intergenic
909554702 1:76940685-76940707 AAGTAGTTAGAAGAGAGGCAGGG - Intronic
910895587 1:92066221-92066243 AAGCAGTTGGATGTGGGGAAGGG + Intergenic
910977370 1:92920930-92920952 AAGGAAAGAGGTGTGGGGCATGG + Intronic
912261850 1:108118633-108118655 GATGAGTCAGATGTGGGGCTGGG - Intergenic
912747085 1:112253915-112253937 AAGAAGGTAGATGTGGAGGAGGG + Intergenic
913090502 1:115473604-115473626 AAGGAGGGGGATGTGGGGTAAGG + Intergenic
914782904 1:150801985-150802007 AATGAGTAAGGGGTGGGGCATGG + Intronic
914922214 1:151854762-151854784 TAGGAGTTGGAGGTGGGGGAGGG + Intergenic
915463972 1:156085163-156085185 ATGCAGTTAGGTGTGTGGCATGG + Intronic
915785711 1:158609139-158609161 AGTGAGATAGAAGTGGGGCATGG + Intergenic
916314749 1:163436793-163436815 AGGGAGTTAGCAATGGGGCAAGG - Intergenic
916502363 1:165397764-165397786 AAGGAGTTAGGTGTAGGGCGGGG + Intergenic
916717886 1:167460548-167460570 GAGTAGTTAGTAGTGGGGCATGG - Intronic
917282640 1:173393394-173393416 AAGGAGACAGTTGTGAGGCAGGG - Intergenic
917521175 1:175749530-175749552 TAGGAGAGAGATTTGGGGCAGGG - Intergenic
919954855 1:202403582-202403604 CAGGACTTTGCTGTGGGGCAGGG + Intronic
920045968 1:203132550-203132572 AAGGGGTTGGAGGTGGGGCATGG + Intronic
920690976 1:208146065-208146087 AAGGAGAAAAAGGTGGGGCAGGG + Intronic
921216280 1:212939287-212939309 ATGGAGGTAGCTGTGGAGCAAGG + Intergenic
921335898 1:214085917-214085939 AAGCAGTTAGATGTGGGGAGAGG - Intergenic
922133409 1:222801386-222801408 AAGGAGTTTGATGAGGAGGAGGG + Intergenic
922237363 1:223732066-223732088 AAGGAGATAGGTGTGGGGCAGGG + Intronic
922879317 1:228968680-228968702 AAGTAATTTGATGTGGGGCCGGG - Intergenic
922988028 1:229881247-229881269 CAGGAGTGAGCTGTGGGGGAAGG + Intergenic
923603777 1:235425296-235425318 ATGGATTTAGGTGTGGGGCATGG - Intronic
924037652 1:239953495-239953517 GAGGACTGAGATGTGGGGTAAGG - Intergenic
924156622 1:241183170-241183192 AAGGATTGAGAGGTGGGACATGG - Intronic
1063133742 10:3199188-3199210 ATGGAGACAGATGTGGGGAAGGG + Intergenic
1067470623 10:46535452-46535474 CATGAGTGAGATGTGGGGCAGGG - Intergenic
1067947121 10:50696612-50696634 AAGGAGAAAGATGCGGGGCTAGG - Intergenic
1068675187 10:59763190-59763212 AAAGAGTGTGATGGGGGGCAGGG - Intergenic
1069448486 10:68496125-68496147 CAGGAGACAGATGGGGGGCAAGG - Intronic
1070717336 10:78732314-78732336 AAGGAGTTAGTCTTGGGGCAAGG + Intergenic
1070793154 10:79201687-79201709 AAGCAGGTGGGTGTGGGGCAAGG + Exonic
1070882432 10:79861602-79861624 AAGGAGAAAGATGTGGGGCTAGG - Intergenic
1071066905 10:81646609-81646631 AAGTAGGTAGATGTGGGGATGGG - Intergenic
1071143165 10:82536475-82536497 AAGAACTTATATGTGGGGGATGG + Intronic
1071649002 10:87377913-87377935 AAGGAGAAAGATGCGGGGCTAGG - Intergenic
1072901549 10:99412067-99412089 AAGGACTTAGAGGTGGGGACTGG + Intronic
1073232810 10:101986778-101986800 AGGGAGCTAGAAGTGGGGGAAGG + Intronic
1073598092 10:104819661-104819683 TAGGAGGTAGATCTGGGGAAAGG - Intronic
1074224774 10:111473847-111473869 AAGGATTCAGCTGTGGGTCAAGG + Intergenic
1074973974 10:118565814-118565836 AATGGATTGGATGTGGGGCATGG - Intergenic
1075386581 10:122059688-122059710 AAGGAGTTAGACATTGAGCAAGG + Intronic
1076471886 10:130724799-130724821 AAGGAGCTACATTTGGGACAGGG + Intergenic
1077664958 11:4099531-4099553 TAGGAGTTAGATGTATGGAAAGG + Intronic
1080086680 11:28291478-28291500 AAGCAGTTTGTGGTGGGGCATGG - Intronic
1080384267 11:31801433-31801455 AAGGAGACAAATGTGGAGCAGGG + Intronic
1080587600 11:33695657-33695679 CAGGAGTTACATCTGTGGCATGG - Intergenic
1083058870 11:59848869-59848891 CAAGAGTTAGACATGGGGCAGGG - Intergenic
1083542228 11:63520103-63520125 AAGGAATTAGATGTGGGGCGGGG + Intergenic
1085016741 11:73178830-73178852 AAGGAGGTAGGTATGGGGCAAGG - Intergenic
1085613953 11:77980215-77980237 ATGGAGTCAGGTGTGGGGGAAGG - Intronic
1085624734 11:78063416-78063438 AAACAGCTTGATGTGGGGCAAGG - Intronic
1085695086 11:78697287-78697309 AAGCAGCAAGATGTGGTGCAGGG + Intronic
1086461355 11:87008827-87008849 AAAGAGTAAGATCAGGGGCATGG - Intergenic
1087773460 11:102236399-102236421 AGGAACTGAGATGTGGGGCACGG - Intergenic
1089807020 11:121099486-121099508 CAAGATTTAGATGTGGGGTACGG - Intergenic
1090335852 11:125964176-125964198 ACGGGGTGAAATGTGGGGCAAGG + Intronic
1090923066 11:131224197-131224219 AAGAAGCTAGGTGTGGGGCCAGG + Intergenic
1091386839 12:101292-101314 ATGTAGGTAGATGTGGGGCAGGG + Intronic
1094659268 12:32450813-32450835 AAGAAGTTACAAATGGGGCAAGG - Intronic
1096004075 12:48154645-48154667 AATGAGTTAAAGGTGGGGCGTGG + Intronic
1096181866 12:49555674-49555696 AAGGAGACAGATGGGGAGCAGGG + Exonic
1096504246 12:52082589-52082611 TGGGAGTGAGATGTGGGGGATGG + Intergenic
1096904941 12:54926719-54926741 CAGAAGTTTGCTGTGGGGCAGGG + Intergenic
1096911510 12:54989248-54989270 AATGAGATAGATCTGGGGAAGGG + Intergenic
1097883961 12:64710632-64710654 CAAGATTTAGATGTGGGACATGG - Intergenic
1098454181 12:70653432-70653454 AAGCAGTTACATGTGGGGTGTGG + Intronic
1099916796 12:88904826-88904848 AAGCAGTTAGTTGTGGTGAATGG - Intergenic
1100961806 12:99970631-99970653 AAGTAGTTTGATATGGAGCATGG - Intronic
1101707061 12:107230529-107230551 GAGGACACAGATGTGGGGCAAGG + Intergenic
1102851165 12:116246735-116246757 AAGGAGTTAGAGGTGGTGGCGGG + Intronic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1103463951 12:121127236-121127258 AAGGAGTTAGATATGGGGCGGGG - Intergenic
1106402624 13:29444640-29444662 AGGGAGTTTGATTTGGGCCAGGG + Intronic
1106557760 13:30824991-30825013 AAGAAGTCAGAGGTGGGGCTGGG + Intergenic
1108556250 13:51595739-51595761 AAAAACTTAGATGTGGGCCAAGG + Intronic
1108974792 13:56425696-56425718 TAGGAGTAAGATGTGGCACATGG - Intergenic
1110793628 13:79612528-79612550 CAGAAGTTTGCTGTGGGGCACGG - Intergenic
1111514192 13:89306283-89306305 AAGGAGGATGAGGTGGGGCATGG + Intergenic
1112071117 13:95851420-95851442 ATGGAGTGAGAAGTGGGTCAAGG + Intronic
1112885371 13:104163894-104163916 AAGGACTTATATTTGGGGAAGGG - Intergenic
1113656179 13:112068818-112068840 AAGGCGCTAGATGTGCGTCAGGG - Exonic
1113897317 13:113774080-113774102 ATGGAGTTGGGTGGGGGGCAAGG - Intronic
1115258687 14:31430603-31430625 AGGGAGAGAGATGTGGGGAATGG - Intronic
1116391799 14:44400768-44400790 AAGGAACTAGAAGTGGGGCAGGG - Intergenic
1118089083 14:62452130-62452152 AAGAAGTTAGAAGTTCGGCAGGG - Intergenic
1118575650 14:67239563-67239585 AAGAACTTAGAGGCGGGGCACGG + Intergenic
1118599542 14:67462238-67462260 AAGAAGTCAGATGTGTGGCAGGG + Intronic
1124033796 15:26034810-26034832 GAGGAGTTAGGAATGGGGCAGGG - Intergenic
1124619234 15:31264678-31264700 AAGGAGGGGGATGAGGGGCAGGG + Intergenic
1125095734 15:35849392-35849414 AAGGGATTAGATGTTTGGCAAGG - Intergenic
1125747391 15:42006207-42006229 AAGGAGGTAGGTCTGGGGGATGG + Intronic
1126692434 15:51298024-51298046 CAGGAGTTAGATGTGGGGAGAGG + Intronic
1126863731 15:52914194-52914216 AAGGTGATAGATTTGGGGAAGGG + Intergenic
1128138599 15:65282804-65282826 AAGGGATTACAAGTGGGGCAAGG + Intronic
1128789173 15:70420310-70420332 AAGGAGTTACTTGTGGTGGAGGG - Intergenic
1129488571 15:75902126-75902148 AAAGAGTTAGCTGAGGGGCGGGG + Intergenic
1129553125 15:76474945-76474967 AATGTGTTAGATGTGGGTCAAGG - Intronic
1130232664 15:82108735-82108757 AAGGAGGCAGATGTGGCACATGG + Intergenic
1130307389 15:82722709-82722731 AAAGAGTTAGTTTTGGGGGATGG - Intergenic
1130809906 15:87365887-87365909 TAGGAGATAGATGTGGGTCCTGG + Intergenic
1132973463 16:2700265-2700287 ATGGAGTGAGCTGTGGGGGACGG - Intronic
1133615946 16:7477080-7477102 AAGGACAGAGATGTGGGGGAAGG - Intronic
1134245823 16:12539279-12539301 AAGGGCTTAGAGGTGGGGGAGGG - Intronic
1134428454 16:14177227-14177249 AAGGAGATAGAGGAGAGGCATGG + Intronic
1136403452 16:30030589-30030611 AAGGAGTTAGGGGTGGAGAAGGG + Exonic
1137514022 16:49126800-49126822 AAGGATTCAGATGTGGGAAAAGG - Intergenic
1137617851 16:49857614-49857636 AATTTGTTGGATGTGGGGCAGGG - Intronic
1138095532 16:54208462-54208484 AAGGCGTTAGATATGGGGCGGGG - Intergenic
1138459719 16:57141063-57141085 AAGGGGAAAAATGTGGGGCAGGG + Intronic
1138902708 16:61294227-61294249 CAGGGGTTAGAAGTGGAGCAGGG - Intergenic
1138967335 16:62100417-62100439 AAGAAGGTATATATGGGGCAGGG + Intergenic
1139169814 16:64616300-64616322 AAGGAGATATCTGGGGGGCAGGG - Intergenic
1139657447 16:68397603-68397625 GAGGAGGCAGATGTGGGGCATGG - Intronic
1140277248 16:73521559-73521581 AAGGAGAGTGATGTGGGGCTTGG - Intergenic
1140328904 16:74033196-74033218 AAAGAGTTATATGTTGGGCTTGG + Intergenic
1140540178 16:75749667-75749689 GAGGAGTTAGATGTGGGGTGGGG + Intronic
1141769716 16:86082457-86082479 AAAGAGAGAGAAGTGGGGCATGG + Intergenic
1142943086 17:3399494-3399516 ATGGAGTTAGAAGAGGAGCAGGG - Intergenic
1143237182 17:5412836-5412858 AAGGAGTTAGATTTGGAGGAAGG + Intronic
1143645830 17:8229419-8229441 AGCCAGGTAGATGTGGGGCAGGG + Exonic
1144994503 17:19258093-19258115 AACCAGTTAGATGTGGGTGAGGG + Intronic
1145997862 17:29114890-29114912 AAGGAGGTAGCTCTGGGGCCTGG - Exonic
1146631912 17:34476205-34476227 AAGGAGTTTGCTGAGGGGCCGGG + Intergenic
1147325820 17:39668961-39668983 ATGGAGGCAGATGTGGGACAGGG + Intronic
1147591511 17:41686906-41686928 AAGGAGTCCACTGTGGGGCAGGG - Intergenic
1148522522 17:48293907-48293929 AAGAAGTTAGAAGTGCGGGAAGG + Intronic
1148643119 17:49203014-49203036 AAGGCGTTAAATGTGGGTCCTGG + Intronic
1149547653 17:57516202-57516224 CAGGAGTTAGGAGTGGGGCCAGG - Intronic
1151420056 17:73991172-73991194 AATGAGTCAGATGTGGGGTGGGG - Intergenic
1151527427 17:74680625-74680647 AGGGAGGCAGAGGTGGGGCAAGG - Intronic
1151680412 17:75620015-75620037 AAGAAGGTAAGTGTGGGGCACGG + Intergenic
1151709762 17:75796958-75796980 TAGGAGTTATATGTGGGGGAAGG + Intronic
1152003444 17:77662019-77662041 AAGGAGTGAGAGGAGGGTCAGGG + Intergenic
1153340459 18:3968180-3968202 CAGGAGAAAGAAGTGGGGCAGGG - Intronic
1153749145 18:8211255-8211277 AAGGGGTGAAATGTGGGGCATGG + Intronic
1155101529 18:22615085-22615107 AAGGAGGCAGCTGTGAGGCATGG + Intergenic
1155505671 18:26530315-26530337 AAGGAGTTAGAGGTTGAGCCAGG + Intronic
1156277139 18:35594201-35594223 GAGGAGTTATTTGTGGAGCAAGG + Intronic
1156388819 18:36631132-36631154 CAGGGGTTTGTTGTGGGGCAGGG + Intronic
1157048004 18:44125764-44125786 GAGGAGGTGGATGTGGGGCACGG + Intergenic
1158415237 18:57244518-57244540 TAGCTGTTAGATGTGGGGCTGGG - Intergenic
1159296008 18:66489714-66489736 AAAGAGTCAGATGTGGGACTTGG + Intergenic
1159545920 18:69839389-69839411 AAGGAGTTAGGGGAGGGGCTAGG - Intronic
1159737400 18:72116838-72116860 AAGGAATGAGAAGTGGGACATGG + Intergenic
1159990653 18:74903020-74903042 AGGGTATTAGAGGTGGGGCAAGG - Intronic
1160489401 18:79324594-79324616 AGGTAGTGGGATGTGGGGCAGGG - Intronic
1161633293 19:5370322-5370344 AAGGAGGTGGAGGTGGGGGAGGG - Intergenic
1162405079 19:10468492-10468514 AAGCAGCTAGAAGTGGGGCGGGG - Exonic
1163106695 19:15127266-15127288 AAGGGGGTGGGTGTGGGGCAGGG + Intergenic
1163260894 19:16189311-16189333 AAGCACTGAGAGGTGGGGCATGG - Intronic
1165914572 19:39249878-39249900 AAGGAGTTAGCTGTGGGGTGGGG - Intergenic
1166499997 19:43333207-43333229 AAGGAGGTAGAGGTGGAGCCTGG - Intergenic
1167577477 19:50324786-50324808 CAGCAGTTAGTTGGGGGGCAAGG + Intronic
925001780 2:408972-408994 CACGAGTTAGATGTGCGACATGG + Intergenic
928156947 2:28885496-28885518 TAGAAGTGAGATGTGGGGCTGGG + Intergenic
929226124 2:39513369-39513391 AAGGGGTTAGATGTAGCACAGGG + Intergenic
932538874 2:72629868-72629890 AAGGAGTTTGATGAAGGTCAGGG - Intronic
932944273 2:76209168-76209190 AAAGACTTAAATGTGGGCCAGGG - Intergenic
934744698 2:96751477-96751499 AGGGACTTGGATGTGGGGAAGGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936925908 2:117736707-117736729 AAGCAGTTAGAACGGGGGCATGG + Intergenic
940182678 2:150953610-150953632 AGGGAGTTAGGGGTGGGGCAGGG - Intergenic
941172332 2:162154535-162154557 AGTGATTTAGATGTGAGGCAAGG + Intergenic
942062737 2:172242928-172242950 AAGAATTGAGAGGTGGGGCATGG - Intergenic
942784753 2:179688181-179688203 TATGAGTTAGAGGTGGGGAAGGG + Intronic
944303243 2:198149065-198149087 GGGGAGTGAGATGTGGAGCAGGG + Intronic
946828451 2:223703229-223703251 TAGTATTTAGATGTGGGGAAAGG - Intergenic
947229701 2:227872481-227872503 AAGCAGTTGGATGTGTTGCAGGG - Intronic
947406807 2:229786786-229786808 AAGGAGTTAGATGGATGGCAGGG - Intronic
948071509 2:235131570-235131592 AAGGCATTCGATGTGGGGCAGGG - Intergenic
948622257 2:239243760-239243782 AAGATGTTAGTTGTAGGGCATGG - Intronic
948622264 2:239243805-239243827 AAGGTGTTAGTTGTAGGGCATGG - Intronic
1169879137 20:10328018-10328040 AATGAGAGGGATGTGGGGCAGGG - Intergenic
1171249789 20:23638499-23638521 GAGGAGGGAGATGAGGGGCATGG - Intergenic
1171263286 20:23750994-23751016 GAGGAGTCAGGGGTGGGGCATGG - Intronic
1172143799 20:32742868-32742890 AGGGAGATAGATGTTTGGCAGGG - Intronic
1172317321 20:33966274-33966296 AAGGACTAAGATCTGGGTCATGG + Intergenic
1173248117 20:41350018-41350040 ATGGAGGAAGATGTGGGCCAGGG - Intronic
1173755888 20:45515677-45515699 AATGAGCTGGATGTGGGGCCAGG - Intergenic
1173884308 20:46443953-46443975 AAGGAGTTAGATGTGGGGCAGGG - Intergenic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1174868844 20:54164728-54164750 AAGGAGGTGGAGGTGGGGTACGG - Intronic
1174947392 20:55003259-55003281 AAGGAGATAGACGCTGGGCAGGG - Intergenic
1175167007 20:57051186-57051208 CAGCAGTTAGATGTGGGACTGGG - Intergenic
1176203152 20:63873133-63873155 AACCATTTAGTTGTGGGGCATGG + Intronic
1177742182 21:25167910-25167932 CAGAAGTTTGCTGTGGGGCAGGG + Intergenic
1177861035 21:26454239-26454261 AAGGAGTTAGAGGTGTAGCTGGG - Intergenic
1178377873 21:32083046-32083068 AAGTAGTTACCTGTGGGGGAGGG + Intergenic
1178795460 21:35739882-35739904 ATGGAGTGGGATGTGGGGAAGGG + Intronic
1178865292 21:36321718-36321740 AAGGAGAGAGAAGTGGGGAAAGG - Intronic
1182692114 22:32171432-32171454 AAGGAGGTAGAGGTAGGACATGG + Intergenic
1182743225 22:32584082-32584104 AAGGGGTTTGAAGTGGGCCAAGG - Intronic
1182796887 22:32997487-32997509 AAGGAGACAGAAGTGGGGCTGGG - Intronic
1183358252 22:37370666-37370688 CAGGAGGTGGGTGTGGGGCAGGG + Exonic
1183727145 22:39596303-39596325 ACGGAGGGAGATGGGGGGCAGGG + Intronic
1183727212 22:39596486-39596508 ATGGAGAGAGATGGGGGGCAGGG + Intronic
1184343209 22:43897531-43897553 AAGGAGTGAAATGTGGGGTCAGG + Intergenic
949147704 3:722584-722606 AAGGAGTAAGTTTGGGGGCATGG + Intergenic
950373711 3:12552699-12552721 AAAGATTTAAATGTGGGGCATGG - Intronic
951671747 3:25190979-25191001 AAAGAGTTAGATGATGGGCGAGG - Intronic
952099314 3:29993322-29993344 AACGGGTTATATGTGGGGAAAGG + Intronic
952154225 3:30625881-30625903 TAGTAGTTAGAGATGGGGCATGG - Intronic
953688584 3:45097955-45097977 AATGAGCTGGATGTGGGGCCAGG - Intronic
955201528 3:56856067-56856089 GAGGAGGAAGATGTGGGGCCAGG + Intronic
958824515 3:99014445-99014467 AAGGAGTTTCATGTTGGCCAGGG + Intergenic
959002511 3:100981306-100981328 GAGGAGTCAGCTGTGAGGCAAGG + Intronic
959987426 3:112590640-112590662 AAGGAGTGAGATCTGGACCAAGG - Intergenic
959992318 3:112643146-112643168 AAGGAGTTGGGTGTGGGGTGGGG - Intronic
960603281 3:119479218-119479240 AAGAAGTTTGAGGTTGGGCACGG - Intronic
961783679 3:129336642-129336664 AGGGAGTTGGAGGTGGGGCTGGG - Intergenic
962007482 3:131362459-131362481 AAGGAATAAGATATGGGGCAGGG - Intergenic
962034108 3:131632715-131632737 AAGGACTCAGCTTTGGGGCATGG - Intronic
962378562 3:134878329-134878351 AATTAGCCAGATGTGGGGCAGGG + Intronic
963788222 3:149556691-149556713 AAGGAATAAGGTTTGGGGCAAGG + Intronic
964155774 3:153583323-153583345 AATGAATTGGAGGTGGGGCAAGG - Intergenic
965961289 3:174431319-174431341 GTGTAGGTAGATGTGGGGCATGG - Intergenic
966621203 3:181966121-181966143 AAACAGTAAGAGGTGGGGCAGGG + Intergenic
966749217 3:183305992-183306014 AATGAGTTAGATGTGTGGTAGGG - Intronic
970518706 4:16861557-16861579 ATGGAGTCAGCTGTGGGGAAGGG - Intronic
970536755 4:17037893-17037915 AAGGAATAGGAAGTGGGGCAAGG + Intergenic
970626294 4:17887785-17887807 AAGGAGCTAAAGGTGGAGCAGGG + Intronic
971796904 4:31239705-31239727 AAGGGGTAAGATGTGTGACACGG - Intergenic
972481400 4:39500478-39500500 AGGGAGTCAGGTGTGGGGAATGG - Intronic
975221764 4:71820769-71820791 AAGGAGGTAGTTTTGGAGCAAGG + Intergenic
975320832 4:73008976-73008998 AGGGAGTAAGATTTGAGGCAGGG - Intergenic
975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG + Intergenic
975495722 4:75034241-75034263 AATGAGGTACATTTGGGGCAGGG - Intronic
978184146 4:105837233-105837255 AAGGAGGTAGTTGTGGGATAAGG - Intronic
978322450 4:107512987-107513009 AAGTATTTATATGTAGGGCAAGG + Intergenic
979127931 4:117000282-117000304 AAAGTTTTAGATTTGGGGCAAGG - Intergenic
979312346 4:119217926-119217948 AAGTAGTTAGATGAGGGGCTGGG + Intronic
979830453 4:125294046-125294068 AAAGAGTTAGATGAGTGGCCAGG + Intergenic
981147423 4:141341386-141341408 ATGGATTGAGATGTGGGGGAAGG + Intergenic
981904825 4:149910387-149910409 AAGGATTTAGATGTGCGAGATGG + Intergenic
982175073 4:152698207-152698229 AAAGAGGTAGAAGTGGAGCAGGG + Intronic
982290790 4:153780420-153780442 AATCTGTGAGATGTGGGGCATGG + Intergenic
982710963 4:158758279-158758301 AAGAAGTGAGAGGTGGGGAAGGG + Intergenic
983182420 4:164664225-164664247 GAGAAGTTAGGTGTGGGGCTAGG - Intergenic
983985267 4:174052233-174052255 AAGGAGTTATGAGTGGGTCATGG - Intergenic
985933848 5:3079850-3079872 AAGGAGTGTGATGCAGGGCAGGG + Intergenic
986182835 5:5409563-5409585 GAGCAGGTGGATGTGGGGCAGGG - Intergenic
986363728 5:7008063-7008085 AAGTAGTTTCATGTGGGGAAAGG - Intergenic
988855487 5:35224247-35224269 GATGAGTTAGATGTGGGGCGGGG - Intronic
990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG + Intronic
990411304 5:55543783-55543805 CTGGAGTTAGAAGTGGGGAATGG + Intergenic
990577517 5:57137539-57137561 GAGGAGGTAGATGTTGGGGAAGG - Intergenic
996064102 5:119062903-119062925 AAGTAGGTAGAGGTTGGGCATGG + Intronic
997073471 5:130643964-130643986 AATGAGTTATGTGAGGGGCAGGG - Intergenic
997083143 5:130764606-130764628 AAGGTAGTAGATGTGAGGCAGGG - Intergenic
997677875 5:135727585-135727607 AAAGAGTGAGATTTGGGTCAAGG + Intergenic
997756760 5:136406785-136406807 AAGCAGTTGGGTGGGGGGCAAGG + Intergenic
997833467 5:137173011-137173033 AGGGAGTTAGATATTGGGTAGGG - Intronic
999812200 5:155138201-155138223 GAGGAGTATGATGGGGGGCAGGG + Intergenic
1000075098 5:157777431-157777453 AAAAAGTTAGGTGTGGGGCCAGG + Intergenic
1001565779 5:172698239-172698261 AAGAAGTTTGCTCTGGGGCAGGG + Intergenic
1002199909 5:177521858-177521880 AGGGAGTTGGACTTGGGGCATGG - Intronic
1004144937 6:13056988-13057010 AAGGAGTTCAGTGTGGGGGAAGG + Intronic
1004203680 6:13572914-13572936 AAGGCGTTAGATGTGGAGTGGGG + Intergenic
1004215042 6:13694484-13694506 CAGGAGCTAGATATGGGGAAGGG + Intronic
1005825188 6:29628039-29628061 CAGGAGGGAGATGTGGGGCTGGG + Intronic
1006433152 6:34010577-34010599 GAGGAGTTGGAGGTGGGGCTGGG - Intergenic
1007626702 6:43250676-43250698 TAGCAGTGTGATGTGGGGCAAGG + Intronic
1009986672 6:70788902-70788924 GAGGAGCAAGATTTGGGGCAAGG + Intronic
1010982092 6:82379619-82379641 AAGGAGTAAGAAGTAGGGAATGG + Intergenic
1012981967 6:105840654-105840676 AAGGAGGGAGATGAGGGTCAGGG - Intergenic
1013079543 6:106800473-106800495 AAGGGCTTTCATGTGGGGCAGGG + Intergenic
1013111130 6:107066140-107066162 AAGAATTTAGATGTGGGGGAAGG + Exonic
1013210486 6:107982635-107982657 CAGCAGTTAGGTGTGGGGGAAGG + Intergenic
1015293518 6:131564339-131564361 AAGGAGTTAGATATAAGGAAAGG - Intergenic
1016794728 6:148105762-148105784 AAGGAGGAAGATGGGGGGAAAGG + Intergenic
1016833570 6:148455711-148455733 AATGAATTAGAAGTGGGGCAGGG + Intronic
1018654681 6:166024186-166024208 AAGGAGTGAGGTGGGGGACAGGG + Intergenic
1018685672 6:166302495-166302517 GATGAATGAGATGTGGGGCAAGG + Intergenic
1019582260 7:1770667-1770689 AAGGTGTTAGCTGTGAGCCAAGG - Intergenic
1020968493 7:14902970-14902992 GAGGAGTGAGAGGTGGGGAAGGG - Intronic
1021197779 7:17691916-17691938 TAGGAGTTGGATGTGGTGCTGGG - Intergenic
1021217816 7:17939712-17939734 AAGGTGATGGATGTGGGGGAGGG + Intronic
1022234981 7:28452686-28452708 AAGCAGCAAGGTGTGGGGCAGGG + Intronic
1022321234 7:29289628-29289650 GTGGAGGTAGATGTGGGGGATGG + Intronic
1023311385 7:38890367-38890389 CAGGAGTTGGATGTGCGGCAAGG + Intronic
1023818914 7:43969634-43969656 CAGGAGGTAGAGGTGGGGCGAGG + Intergenic
1025154507 7:56592111-56592133 GAGGAGAAAGATGTGGGACAGGG - Intergenic
1025200557 7:56958808-56958830 AAAGAGGTAGATGGGGGGGAGGG + Intergenic
1025671387 7:63618124-63618146 AAAGAGGTAGATGGGGGGGAGGG - Intergenic
1026128397 7:67599525-67599547 AAGGAGTGCGATGTGGGTCTGGG - Intergenic
1026308024 7:69159506-69159528 AAGGATCTGGAGGTGGGGCATGG + Intergenic
1027414636 7:77962178-77962200 AAAGAGTTAGATGAGAGGCAGGG - Intergenic
1029743964 7:102506597-102506619 CAGGAGGTAGAGGTGGGGCGAGG + Intronic
1029761953 7:102605760-102605782 CAGGAGGTAGAGGTGGGGCGAGG + Intronic
1033457757 7:141517884-141517906 AAGGACTGAGAAGTGTGGCAGGG - Intergenic
1033771618 7:144558745-144558767 TATGGGTTAGATGTGGGGTATGG - Intronic
1035333876 7:158113423-158113445 AAGGTGCTGGATGTAGGGCATGG + Intronic
1035391410 7:158507144-158507166 CAGGGCTTGGATGTGGGGCAAGG + Intronic
1036224025 8:6943260-6943282 GAGGAGTCAGACATGGGGCATGG + Intergenic
1036959091 8:13224551-13224573 CAGGACTTGGATGTGGGGTAAGG + Intronic
1037115427 8:15220450-15220472 AAGCAGTTAGAAATGGGGCAAGG - Intronic
1037778631 8:21852267-21852289 AAGGAGATAGATTCAGGGCATGG - Intergenic
1038379497 8:27079309-27079331 AAGAAGGTGGAGGTGGGGCAGGG - Intergenic
1038671870 8:29589385-29589407 AAGGGCTCAGCTGTGGGGCATGG + Intergenic
1039460992 8:37744265-37744287 ATGGCGTAAGATGTGGGGCTTGG - Intronic
1043397866 8:79856214-79856236 ATGGAGATAGAAGTGGGGAAGGG + Intergenic
1047533558 8:125698788-125698810 GAAGAGAGAGATGTGGGGCAAGG - Intergenic
1047701077 8:127449927-127449949 CAGGATATACATGTGGGGCAGGG + Intergenic
1049267266 8:141675028-141675050 AAGGAGCTAGCTGTGGGCCTGGG - Intergenic
1051507707 9:17844143-17844165 AAGGAGCTAGAAGTGAGGAATGG - Intergenic
1052212848 9:25927874-25927896 AAGGAGAGAAATGTGGGACAAGG + Intergenic
1053073648 9:35115542-35115564 GAGGAGGTACATGAGGGGCAGGG - Intronic
1053781984 9:41619188-41619210 AAGAAGTTTGCTGTGGGGGAGGG - Intergenic
1054169935 9:61829342-61829364 AAGAAGTTTGCTGTGGGGGAGGG - Intergenic
1054667603 9:67751473-67751495 AAGAAGTTTGCTGTGGGGGAGGG + Intergenic
1054707877 9:68480978-68481000 AAGAACTTGGAGGTGGGGCAAGG + Intronic
1055785330 9:79864429-79864451 AAGGAGAAAGGTGTGGGGCTAGG - Intergenic
1056019817 9:82430200-82430222 AAGGAGAAAGATGTGGGGCTAGG + Intergenic
1056575901 9:87856084-87856106 AAGGAGAAAGATGCGGGGCTAGG + Intergenic
1056602318 9:88055697-88055719 AAGGAGACAGGTGTGAGGCAGGG + Intergenic
1057072021 9:92106830-92106852 AAGGAGAAAGATGTGGGGCTAGG - Intronic
1057082167 9:92181229-92181251 AAGGAACTAGAGGAGGGGCAGGG + Intergenic
1057857083 9:98610036-98610058 CAGGAGTTTGGTTTGGGGCATGG - Intronic
1058348137 9:103989271-103989293 AATGAGTTAGCTGTGTGGCTTGG - Intergenic
1058585820 9:106505043-106505065 AAGGAGTTTGATGTGGCATAGGG + Intergenic
1059605361 9:115828978-115829000 AAGGATTTAGAGGTGGGATATGG - Intergenic
1060788750 9:126471097-126471119 AACTAGTTAGAAGTGGGGCCTGG + Intronic
1061120693 9:128640634-128640656 GAGGAGACAGAAGTGGGGCAGGG + Intronic
1185885024 X:3774914-3774936 AAGAAGTCAAAGGTGGGGCACGG + Intergenic
1186033857 X:5399437-5399459 AAGGAGTTTGTTTTGGGACAGGG - Intergenic
1187266289 X:17737251-17737273 GAGGAGATAGCTGTGGGGCGGGG - Intergenic
1187266301 X:17737293-17737315 AAGGAGATGGCTGTGGGGCGGGG - Intergenic
1187293932 X:17980997-17981019 AAGGAGTAAGGGGTGGGGTAGGG - Intergenic
1190092949 X:47455597-47455619 AAAGACTAAGATGGGGGGCAGGG + Intronic
1190094240 X:47466305-47466327 AAGGAGGGAGCTGTCGGGCAGGG + Intronic
1190517133 X:51235496-51235518 GAGGAGTTAGTTGTGGGCAAGGG + Intergenic
1196747581 X:119085562-119085584 AAGGAGTTAGAACTGAAGCAAGG + Intronic
1198804793 X:140483618-140483640 CAGGAGTTAGTGGTGGAGCATGG - Intergenic
1198934590 X:141893390-141893412 GAGGAGTTAGGGTTGGGGCAAGG + Intronic
1199047243 X:143189441-143189463 AAGGGGTAAGATGGGAGGCAAGG - Intergenic
1199787240 X:151116454-151116476 AAGGAGCAAGGTGTGAGGCATGG - Intergenic
1200246674 X:154530223-154530245 AAGGAGCTTGATGGGGGCCAAGG - Intergenic