ID: 990160765

View in Genome Browser
Species Human (GRCh38)
Location 5:52937476-52937498
Sequence TACCCTGTGCTGTACCCAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990160762_990160765 -1 Left 990160762 5:52937454-52937476 CCCCAATATGACATCAAATGGTT 0: 1
1: 0
2: 0
3: 11
4: 117
Right 990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG 0: 1
1: 0
2: 0
3: 7
4: 94
990160763_990160765 -2 Left 990160763 5:52937455-52937477 CCCAATATGACATCAAATGGTTA 0: 1
1: 0
2: 0
3: 15
4: 226
Right 990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG 0: 1
1: 0
2: 0
3: 7
4: 94
990160760_990160765 25 Left 990160760 5:52937428-52937450 CCAGAGCTTAAGCTGTCAATTTC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG 0: 1
1: 0
2: 0
3: 7
4: 94
990160764_990160765 -3 Left 990160764 5:52937456-52937478 CCAATATGACATCAAATGGTTAC 0: 1
1: 0
2: 1
3: 10
4: 105
Right 990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990160765 Original CRISPR TACCCTGTGCTGTACCCAAC TGG Exonic
904505935 1:30953981-30954003 TATCCTGTTCTGTAACCAACAGG - Exonic
905258902 1:36703878-36703900 TGCCCTCTGCTGCCCCCAACTGG - Intergenic
906714273 1:47955348-47955370 TATTCTGTGCTGTAGACAACTGG - Intronic
908768943 1:67578538-67578560 TACCCTTAGCTGTGGCCAACAGG - Intergenic
911688647 1:100806266-100806288 AACACTGTGCTTTAACCAACAGG + Intergenic
912433154 1:109640378-109640400 GTCCTTGTGCAGTACCCAACTGG + Intergenic
913293484 1:117296759-117296781 CACCCTCTGCTTTACACAACTGG - Intergenic
915712639 1:157916079-157916101 TAGCCTGTGCTCTAGCCAAAGGG - Intergenic
916165749 1:161965691-161965713 TACCCTGTAATTTACCTAACTGG + Intergenic
922765074 1:228152343-228152365 GACCCTGTGCTACACCCAGCAGG + Intronic
923162822 1:231331426-231331448 TACCTCTTGCTGTACCCCACTGG - Intergenic
1067109147 10:43387166-43387188 TAGCCTGTGCTGTAGGCACCAGG + Exonic
1067508686 10:46877430-46877452 CACCCTGTGTTGTACCCACCGGG + Intergenic
1067577915 10:47419565-47419587 GAGCCTGTGGTGTACCCAGCAGG - Intergenic
1067653565 10:48174420-48174442 CACCCTGTGTTGTACCCACCAGG - Intronic
1069896291 10:71682240-71682262 GACCCTGTGCTGCGCCCACCAGG - Intronic
1070265266 10:74896108-74896130 TAACCTGGGCTGTACCTAAGAGG - Intronic
1070415939 10:76189416-76189438 GATGCTGTGCAGTACCCAACAGG - Intronic
1079080858 11:17412793-17412815 GACACTGTCCTGTACCCTACTGG + Intronic
1081806696 11:45894774-45894796 GACCCTATACTGTACCCAGCAGG - Intronic
1093097288 12:14985707-14985729 TACCCAGTGCTGAAACAAACAGG - Intergenic
1094717463 12:33027397-33027419 TGACCTGTGCTGTACCCTATAGG - Intergenic
1095307796 12:40658695-40658717 TGCCCTGTGATGTTCCCAAGTGG - Intergenic
1097250361 12:57629065-57629087 AACCCTCGGCTGTACCCACCTGG - Exonic
1098504470 12:71233311-71233333 TCCCCTGTGATGTACCCAGTTGG + Intronic
1100794548 12:98166896-98166918 CACCAGCTGCTGTACCCAACTGG - Intergenic
1114081164 14:19202202-19202224 TCCCCTCTGCTGTACCCATGTGG - Intergenic
1119430190 14:74562303-74562325 TAATCTGTGCTTTACCCAAATGG - Intronic
1121608584 14:95259655-95259677 TGCCCTGTGCTGGTCCCACCTGG - Intronic
1123111352 14:105868396-105868418 TACCCTGTGTTCTAGCCATCTGG - Intergenic
1125435529 15:39640785-39640807 TACACTGACCTGTAACCAACCGG - Intronic
1125739252 15:41950510-41950532 AACCCTGTGCTGTTCCCAGACGG + Intronic
1127232293 15:57009960-57009982 GTCCCTGTGCTTTCCCCAACAGG - Intronic
1127846993 15:62878632-62878654 TACCTTGTGCTGTACACAGTAGG - Intergenic
1128379442 15:67101324-67101346 TACCCTGTGCTGGGGCCAACAGG - Intronic
1131279244 15:91007405-91007427 TTCCCTGTTCTGTACCCTCCTGG - Intronic
1131873390 15:96782074-96782096 TATTCTGTGCTGTACCCACAAGG + Intergenic
1132872088 16:2119779-2119801 TCTCCTGTTCTGAACCCAACAGG + Intronic
1134520437 16:14917117-14917139 TCTCCTGTTCTGAACCCAACAGG - Intronic
1134551138 16:15138857-15138879 TCTCCTGTTCTGAACCCAACAGG + Intronic
1134708109 16:16315768-16315790 TCTCCTGTTCTGAACCCAACAGG - Intergenic
1134715324 16:16355801-16355823 TCTCCTGTTCTGAACCCAACAGG - Intergenic
1134951493 16:18352877-18352899 TCTCCTGTTCTGAACCCAACAGG + Intergenic
1134959433 16:18396358-18396380 TCTCCTGTTCTGAACCCAACAGG + Intergenic
1136109990 16:28058761-28058783 ACCCCTGTGATGTCCCCAACCGG - Intronic
1136229317 16:28877559-28877581 CACACTGTGCTCTAACCAACGGG - Intergenic
1138308116 16:55997221-55997243 TACTCTGTGCTGTCCCAAAGTGG + Intergenic
1140225656 16:73074538-73074560 TACTCAGTGCTGTACCCATGGGG + Intergenic
1149547447 17:57514371-57514393 ACACCTGTGCTGTACCCCACTGG - Intronic
1149958637 17:61081937-61081959 TACACTGTCCTGTACCCCATAGG + Intronic
1152353563 17:79796301-79796323 TCCCATGTGCTGTACCTAAAGGG + Exonic
1154499256 18:14986922-14986944 TCCCCTCTGCTGTACCCATGTGG + Intergenic
1156666238 18:39411179-39411201 TACCCTGAGCTGTGCCTGACAGG - Intergenic
1157760801 18:50263825-50263847 TACCATGAGCAGTACCCAAGGGG + Intronic
1159964215 18:74579893-74579915 AACCCTGAGCTGTACCCAGAGGG - Intronic
1164700679 19:30281834-30281856 TACTCTGAGCTGCACCAAACTGG + Intronic
925358580 2:3261509-3261531 TACCCTAGTCTGTACCCAAAGGG + Intronic
938568695 2:132542917-132542939 GACCCTGAGCTGCACACAACTGG - Intronic
940766116 2:157791157-157791179 TGACCTTTGCTGTATCCAACTGG + Intronic
940947624 2:159636431-159636453 AAACCTGTGCTGGACTCAACTGG + Intergenic
1175200461 20:57273322-57273344 TCCCCAGTGCTGTATCCAGCAGG - Intergenic
1176085176 20:63292641-63292663 GACCCTGGGCTGCTCCCAACTGG - Intergenic
1180103128 21:45599231-45599253 CACCCTGTGCTTTCCCCAGCTGG + Intergenic
1180499609 22:15920484-15920506 TCCCCTCTGCTGTACCCATGTGG + Intergenic
1183490620 22:38113654-38113676 GCCCCTGTCCTGTTCCCAACAGG - Exonic
1183825520 22:40383667-40383689 TACCCTAAGCTTTAGCCAACTGG - Intronic
1184326755 22:43793705-43793727 TACTCTGTGGGGTACCCATCTGG + Intronic
954105190 3:48405978-48406000 TACCCTGTTCTGTCCCCATCTGG - Intronic
955906500 3:63813396-63813418 TGCTCTGGGCTGTACCCCACTGG - Intergenic
960973694 3:123156474-123156496 TACCCTGTGCTGTGCACAAGTGG - Intronic
961020342 3:123500661-123500683 TTCATTGTGCTGTACCCAATGGG - Exonic
961378341 3:126481717-126481739 TCCCCTTTGCTGTACCCCTCAGG + Intronic
967305218 3:188052590-188052612 TACCCTGTGCTGCCTCCAGCAGG - Intergenic
971536829 4:27762819-27762841 TAACCTGTGATGTACCGAATCGG - Intergenic
976902752 4:90199095-90199117 AACCCATTGCTGTACCCAGCTGG + Intronic
978002040 4:103567864-103567886 TACCCTGTCCTCAACCTAACAGG - Intergenic
979437350 4:120709521-120709543 TACCCTATGCTGTATCCATTGGG + Intronic
982968726 4:161950769-161950791 TAACCTGGGCTGTAGCCAGCAGG - Intronic
983179073 4:164626283-164626305 TAGCTTGTGCTGTATCCCACAGG - Intergenic
990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG + Exonic
994465022 5:100116024-100116046 GACCCTGAGGTGTACACAACAGG + Intergenic
995577147 5:113550137-113550159 TCCCCTGTGCTGTACCTGCCCGG - Intronic
997340846 5:133143486-133143508 TAGCCTGTTCTGAACCCAGCAGG + Intergenic
999303721 5:150506862-150506884 GGCCCTGTGTTGTACCCACCAGG + Intronic
1001311216 5:170612344-170612366 TTCTCTGTGCTGTGCCCAGCAGG - Intronic
1007750368 6:44067473-44067495 TATCCTATGCTGTAGCCACCTGG + Intergenic
1012785688 6:103622700-103622722 TAGCCTGAGCTGTACTCAATAGG - Intergenic
1012890407 6:104890810-104890832 TACCCGGTGATGTAGCCAAAAGG + Intergenic
1016107164 6:140177211-140177233 TTCCCTGTTCTGTATCTAACTGG - Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019380248 7:717900-717922 TCACCTTTGCTGTACCCCACCGG - Intronic
1028430492 7:90741359-90741381 TACCTTGTGCTGTATACACCTGG + Intronic
1034393422 7:150802530-150802552 TTCCCAGTGCTGTTCCCACCAGG + Intronic
1035815166 8:2531160-2531182 TACGCTCTGTTGTATCCAACAGG + Intergenic
1037188143 8:16089747-16089769 TACCATGAGCAGTCCCCAACAGG + Intergenic
1039059634 8:33563487-33563509 TAAACTTTGCTGTGCCCAACAGG + Intronic
1049647103 8:143740382-143740404 GACCCTGCGCTGTTCCCGACCGG + Intergenic
1053250099 9:36567157-36567179 CATCCTGTGCTCCACCCAACTGG + Intergenic
1057179035 9:93019965-93019987 GGCCCTGTGCTGTACCCTGCAGG + Intronic
1060206815 9:121687042-121687064 TACCCTCTGCTGCCCCCAACTGG - Intronic
1061856191 9:133443158-133443180 TGCCCTGTCCTGCACCCAGCAGG - Intronic
1194893680 X:99412464-99412486 TACACTGTGCTGTATCAAATTGG - Intergenic