ID: 990168202

View in Genome Browser
Species Human (GRCh38)
Location 5:53018197-53018219
Sequence TAAAGTCTCCTATAGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 3, 2: 30, 3: 40, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990168194_990168202 13 Left 990168194 5:53018161-53018183 CCCTGCTCTGTCCGGGTCCAACA 0: 1
1: 3
2: 16
3: 49
4: 185
Right 990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG 0: 1
1: 3
2: 30
3: 40
4: 157
990168190_990168202 29 Left 990168190 5:53018145-53018167 CCCACGGGCAAGACTGCCCTGCT 0: 2
1: 4
2: 14
3: 44
4: 133
Right 990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG 0: 1
1: 3
2: 30
3: 40
4: 157
990168195_990168202 12 Left 990168195 5:53018162-53018184 CCTGCTCTGTCCGGGTCCAACAG 0: 1
1: 2
2: 14
3: 56
4: 176
Right 990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG 0: 1
1: 3
2: 30
3: 40
4: 157
990168196_990168202 2 Left 990168196 5:53018172-53018194 CCGGGTCCAACAGTCACCCTAAG 0: 1
1: 1
2: 7
3: 19
4: 100
Right 990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG 0: 1
1: 3
2: 30
3: 40
4: 157
990168198_990168202 -4 Left 990168198 5:53018178-53018200 CCAACAGTCACCCTAAGGCTAAA 0: 1
1: 3
2: 15
3: 112
4: 1681
Right 990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG 0: 1
1: 3
2: 30
3: 40
4: 157
990168191_990168202 28 Left 990168191 5:53018146-53018168 CCACGGGCAAGACTGCCCTGCTC 0: 2
1: 2
2: 13
3: 37
4: 224
Right 990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG 0: 1
1: 3
2: 30
3: 40
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990168202 Original CRISPR TAAAGTCTCCTATAGGAGCA CGG Intronic
903932589 1:26871929-26871951 GAAAGTCTAAGATAGGAGCAGGG - Intergenic
904047905 1:27619824-27619846 CAAAGTCTCCTTAAGGAGCTGGG - Intronic
906658153 1:47563737-47563759 TAAATCCTCCTACAGGGGCAGGG + Intergenic
908265633 1:62376764-62376786 TAAAGTCTGCTGCAGAAGCAGGG + Intergenic
911807743 1:102233374-102233396 TAGAGCTTCCTGTAGGAGCATGG - Intergenic
912089163 1:106049316-106049338 TAAAGTCCCCTATAAGAGAAAGG - Intergenic
912155586 1:106914976-106914998 CAAAGTCTCCTACGGGATCATGG - Intergenic
912479828 1:109974323-109974345 TACAGTTTCCTATAGCTGCACGG + Intergenic
915817671 1:158986713-158986735 TAAAGCCACCTAGAGGAGTATGG + Intergenic
916368467 1:164061407-164061429 TAAAGTCTCCTAAAGGAGCATGG - Intergenic
917011731 1:170481827-170481849 CAAAGCCTCCTAGAGGAACATGG + Intergenic
917145901 1:171891153-171891175 TACAGTCTCCTATATAAGGAAGG + Intronic
917895611 1:179484340-179484362 TAATGTCTCCTAAAGGAGCAAGG - Intronic
918860927 1:189825702-189825724 TAAAGCCACCTAGAGGAGCATGG - Intergenic
921303579 1:213773108-213773130 TAATGTCTTTTATAGGGGCAGGG + Intergenic
921571894 1:216789791-216789813 TAAAGCCTCATATAGGAGAAAGG + Intronic
921789629 1:219274855-219274877 CAAAGCCTCCTATAAGAGGAGGG - Intergenic
923743438 1:236677608-236677630 TAAAGTTTCTTTTAGGAACAAGG + Intergenic
1065266253 10:23979360-23979382 TAAATTCTCCTAGAGCAGGAAGG - Intronic
1066546763 10:36508601-36508623 TAAGTTCCCCTATAGGATCAGGG - Intergenic
1068131945 10:52906063-52906085 TAATGTCTCCTATAAAAACATGG + Intergenic
1068314126 10:55319886-55319908 TAAAGTCTACTGTGGGAGCAAGG - Intronic
1068440812 10:57053177-57053199 TAAATTCTCCTAAAGGAGTATGG - Intergenic
1073311582 10:102546618-102546640 TAAAGTCTCCTGGAGGGGCCTGG - Intronic
1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG + Intergenic
1077792997 11:5461543-5461565 TAAAGTCACCTACAGGAGTGTGG + Intronic
1077841701 11:5982626-5982648 CAAAGCCACCTAGAGGAGCATGG + Intergenic
1079429331 11:20373803-20373825 TAAAGTCTCCATTTGGAGAATGG + Intronic
1079747409 11:24150676-24150698 TAAAGTTTCCTAGAGGAGTATGG + Intergenic
1080272926 11:30469842-30469864 TAAATTTCCCTAAAGGAGCATGG + Intronic
1081379265 11:42394828-42394850 TTAAGGCTCCTAGGGGAGCATGG - Intergenic
1082691367 11:56308469-56308491 TGAAGCCTCCTAGAGGAGCTTGG + Intergenic
1083966089 11:66044827-66044849 TGAAGTCTCCGAGAGGTGCAGGG + Intronic
1084925903 11:72511067-72511089 TAAAGTCTCCTGAAGGAGCATGG + Intergenic
1086954511 11:92921892-92921914 TAAAGACTGGTACAGGAGCAAGG - Intergenic
1087917841 11:103831209-103831231 TAAAGTCTCCTAGAGGAATCTGG - Intergenic
1090217723 11:124984494-124984516 TAATGTCTCCTAGGGGAGCAAGG + Intronic
1093231294 12:16546218-16546240 TAAACTCTTCTCCAGGAGCAGGG + Intronic
1093490637 12:19700668-19700690 TAAAGTGTCCTAGAGGAGCATGG - Intronic
1093542060 12:20299026-20299048 TAAAGACACCTAGAGAAGCATGG + Intergenic
1095916473 12:47485110-47485132 TTGAATCTCCTATAGGAGAATGG + Intergenic
1097512855 12:60565356-60565378 TAAAGTATCCTAGGGGAGCATGG + Intergenic
1098704011 12:73664789-73664811 TAAAGTCTCCTAAGGGAACAAGG - Intergenic
1100926918 12:99558794-99558816 TAAAGCCTCCTGGAGGAGCATGG + Intronic
1101275685 12:103198479-103198501 CAAAGCCACCTAGAGGAGCATGG + Intergenic
1101471318 12:104999565-104999587 TGAAGTCTCTTAGGGGAGCAAGG + Intronic
1101520745 12:105479804-105479826 TAAAGTGTCTTATTTGAGCAGGG - Intergenic
1104162517 12:126193555-126193577 TAATCTCCCCTTTAGGAGCAAGG - Intergenic
1107626317 13:42289274-42289296 TAATATCTCCTATAGAGGCAGGG + Intronic
1107831342 13:44376058-44376080 TAAAAACTCTTATAGGTGCAAGG - Intronic
1108839307 13:54592990-54593012 TAAAGTCTCCTAGGAGAGCATGG - Intergenic
1109955701 13:69562883-69562905 TAAAGTCTCCTAGAGGAACATGG - Intergenic
1115869000 14:37778907-37778929 TAAAGTCTCCAAGGGGAGCATGG + Intronic
1116282726 14:42929087-42929109 TAAAACTTCCTAGAGGAGCATGG + Intergenic
1118646621 14:67846801-67846823 TAAAGTCTCCTAGGAGAGCATGG + Intronic
1120509791 14:85399350-85399372 GCAAGTCTCCTAGAGCAGCAGGG + Intergenic
1122444341 14:101758347-101758369 AAAAGTGTCCCAGAGGAGCAGGG + Intergenic
1123126990 14:105953882-105953904 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1202857550 14_GL000225v1_random:60394-60416 TAAAGTCTCCTGTAGGCAGAGGG + Intergenic
1123407452 15:20029702-20029724 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123516779 15:21036358-21036380 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123721260 15:23063840-23063862 TAAAATCTCCCAGAGGAGCATGG - Intergenic
1123875764 15:24622251-24622273 TGAAGTCTCCTAGGGGAGCACGG + Intergenic
1123893886 15:24809257-24809279 TAAAGTTTCCTAGAGCTGCATGG - Intergenic
1124512030 15:30335801-30335823 TAAATTTTCCTATAAGAGAAAGG + Intergenic
1124730884 15:32194950-32194972 TAAATTTTCCTATAAGAGAAAGG - Intergenic
1126517944 15:49556752-49556774 GAAAGTCTCCTAGGGTAGCATGG + Intronic
1127556891 15:60096309-60096331 TAAAGCCTCCAGAAGGAGCATGG - Intergenic
1129014806 15:72457113-72457135 TATTGTCTCCTATAAAAGCAAGG + Intergenic
1129502159 15:76049714-76049736 GAAAATCTCATGTAGGAGCAAGG - Intronic
1129570775 15:76681892-76681914 TAAAATCTCCTAGAGGAGCATGG - Intronic
1136651248 16:31673484-31673506 TAAAGTCACCTGGAAGAGCATGG + Intergenic
1137316478 16:47329415-47329437 CACAGTCTACTTTAGGAGCATGG + Intronic
1138859965 16:60744223-60744245 TAAAGTTTGCTACAGGGGCAGGG - Intergenic
1139099068 16:63743947-63743969 TAAAGTCTTCTAGAGGAGGATGG - Intergenic
1140859232 16:79004849-79004871 TAAAATCTCACATAGGTGCACGG - Intronic
1147760395 17:42794505-42794527 TACAGACTCCTATAGGTTCATGG + Intronic
1149047742 17:52267286-52267308 TAAAATCTCTTGTAGGAGTAAGG - Intergenic
1149123008 17:53192561-53192583 TAAAGTCTCTTAGAGAAGTAAGG - Intergenic
1149127538 17:53254260-53254282 TAGAGTCTTCTAGAGGAGTATGG - Intergenic
1149363109 17:55914343-55914365 TAAAGTCTCCTAGAGGAACATGG + Intergenic
1150533840 17:66014450-66014472 TAAAGTCTCCTAGAGGAACATGG + Intronic
1153399359 18:4666615-4666637 TAAAGTCTCCTAAGAGAGCAAGG - Intergenic
1154400776 18:14034722-14034744 TAAAATCTCCTAGGTGAGCATGG - Intergenic
1155835375 18:30575515-30575537 TACAGTATCCCATAGGAGCATGG - Intergenic
1157165927 18:45358400-45358422 AGAAGTGGCCTATAGGAGCAGGG - Intronic
1158175536 18:54651944-54651966 CAAAGTCTTCTATATTAGCATGG - Intergenic
1159274173 18:66193926-66193948 CAAAGGCACCTAGAGGAGCATGG + Intergenic
1159533913 18:69691339-69691361 GAAAGTCTTTTATAGGAGAAGGG + Intronic
1159805679 18:72956066-72956088 GAAAATCTCCTAGAGGAGCCTGG + Intergenic
1159846556 18:73468006-73468028 TAAAGTTTCTTATAGGAGTAAGG + Intergenic
1165912033 19:39235376-39235398 TAAAGTCACATATACAAGCAAGG + Intergenic
1166909156 19:46138861-46138883 CAAAGCCACCTAGAGGAGCAAGG + Intergenic
927011015 2:18904356-18904378 TAAAGTCTCCTATAATTACAAGG - Intergenic
928680750 2:33700008-33700030 CAAAGTGTCCTAGAGAAGCATGG - Intergenic
930943018 2:57036167-57036189 TAAAGTCACCTAGAGGATCATGG + Intergenic
931557172 2:63518618-63518640 TAAAGTCTCCTAGGGGTGCCTGG - Intronic
934099629 2:88640815-88640837 TAACGTCTCCTATGGGAGCAAGG - Intergenic
935871544 2:107455923-107455945 CAAAGCCACCTAGAGGAGCATGG - Intergenic
936020300 2:108989432-108989454 TAAAGGCTCTGATAGAAGCAAGG - Intergenic
936692818 2:114912944-114912966 TAAAGCCACCTAGAGGAGCATGG - Intronic
936796020 2:116204681-116204703 TAAAGTCTCTTAGAGGAGCATGG + Intergenic
936811967 2:116413371-116413393 TAAAGTCTCCTAAAGGATCATGG - Intergenic
939505270 2:143038355-143038377 AAAATTCTCCCAGAGGAGCAGGG - Intronic
940531818 2:154887090-154887112 TAAAGTCTCCTAGAGGAGTATGG + Intergenic
943830330 2:192452757-192452779 TAAAGTCTCCTAGAGGAGCTCGG - Intergenic
947263641 2:228252346-228252368 TGGAGTCTCCTAGAGGAACATGG + Intergenic
947281518 2:228460644-228460666 TAGAGTCTTCTAAGGGAGCACGG + Intergenic
947345603 2:229186449-229186471 CAAAGTTTGCTATAGGAGCAGGG - Intronic
1169958404 20:11131519-11131541 TAAAGTCTACTATGGAAGAATGG + Intergenic
1177577466 21:22976779-22976801 TATTTTCTCCTATAGGAGAAGGG - Intergenic
1178919543 21:36729584-36729606 TAACGTCTCCTATCCTAGCAAGG + Intronic
1178940405 21:36900675-36900697 TAAAGTCACCTAAATGAGCTAGG + Intronic
1181930024 22:26393451-26393473 TATAGTGTCCTATAGCAGCTAGG + Intergenic
951258766 3:20482090-20482112 TAAAGTCTCCTAAGGGAGCAAGG - Intergenic
956032144 3:65050107-65050129 TAGAGTCTCCAAAGGGAGCATGG - Intergenic
956378849 3:68644817-68644839 CAAAGCCACCTAGAGGAGCATGG + Intergenic
957262279 3:77917606-77917628 TAACGTTTCCTATATGAGGATGG - Intergenic
957878788 3:86183599-86183621 CAAAGACACCTAGAGGAGCATGG - Intergenic
958064775 3:88529093-88529115 CAAAGCCACCTAGAGGAGCATGG + Intergenic
958259565 3:91364601-91364623 TAAAGTCACCTTCAGGAGTATGG - Intergenic
958739248 3:98048517-98048539 AAAATTCTTCTATAGGAGAAAGG + Intergenic
959440030 3:106362796-106362818 TAAAGTCTCCTATGGGAGTATGG + Intergenic
959688877 3:109177221-109177243 TTTAGGCTACTATAGGAGCATGG + Intergenic
961871168 3:129989183-129989205 TAAAGTCTCCCATAAGGGCCGGG - Intergenic
962001778 3:131305522-131305544 TAAAGTCTCCTAAAGGAGCATGG + Intronic
962655796 3:137542830-137542852 TAAGGTCTCCTAGGGGAACAAGG + Intergenic
962993853 3:140605516-140605538 CAAAGCCTCCTAGAGGAACATGG - Intergenic
964296580 3:155240234-155240256 TAAAGTATCCTAGGGAAGCAAGG + Intergenic
964486099 3:157186481-157186503 TAAACTCTCCTAGGGGAGCATGG - Intergenic
970703496 4:18771197-18771219 TAAAGCCACCTAGAGGAGTATGG - Intergenic
971729680 4:30361337-30361359 TAAAGCTTCCTAGAGGAGCAAGG + Intergenic
973034664 4:45390954-45390976 TAAAGCTACCTAGAGGAGCATGG + Intergenic
974089438 4:57296017-57296039 TACAGTCTCACATAGGAACAGGG + Intergenic
974543847 4:63275156-63275178 TAAAGTCACCTATAGGAGCTTGG - Intergenic
974650551 4:64748750-64748772 TAAAGTCTCCTATGGGAGCGAGG + Intergenic
975124144 4:70762820-70762842 TGCAGTCTTTTATAGGAGCAGGG + Intronic
975909174 4:79247991-79248013 TAAAGTCTCCTAGGGGAGCAAGG - Intronic
976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG + Intronic
978940954 4:114435239-114435261 TAAAGTCTTCTATGGGAGCCTGG + Intergenic
980263684 4:130487824-130487846 AAAAGTCTCCTCCAGGAGAAAGG + Intergenic
980532262 4:134070932-134070954 TAAAGTCTCCTAGAGGAGCATGG + Intergenic
980576439 4:134688259-134688281 TACAGTCTCCTAGAGGAGCGTGG + Intergenic
980880580 4:138706324-138706346 TAAAGTTTCCAAAAGAAGCAAGG + Intergenic
981757375 4:148155131-148155153 TACAGTCTCTTATAGGAGACAGG - Intronic
983413277 4:167424608-167424630 TAAAGTCTTCCAGAGGACCATGG - Intergenic
985131490 4:186742409-186742431 TAATGTGTCCTATATGGGCAGGG + Intergenic
986467525 5:8041148-8041170 TAAAGTCTCCTAAGGGAGCAAGG + Intergenic
988323893 5:29737519-29737541 TAAAGTCTCTTAGGAGAGCATGG - Intergenic
989216223 5:38907469-38907491 CAAAGTCTCCTAGAGGAGCAAGG - Intronic
989733852 5:44679316-44679338 TAATGTCTCCTAGAGGAGCATGG - Intergenic
989779552 5:45247561-45247583 CAAAGCCACCTAGAGGAGCATGG + Intergenic
990134705 5:52631295-52631317 CAAAGTCACCTATAGGAGTATGG + Intergenic
990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG + Intronic
992079287 5:73218944-73218966 TAAAGTGTCCATCAGGAGCAGGG + Intergenic
994176699 5:96719155-96719177 TAAGGGCTTCTATAGAAGCAGGG - Intronic
994212566 5:97102548-97102570 TAAATTCTCCTAAAGGAGTCTGG - Intronic
994613670 5:102077655-102077677 TAAAATCTCCTAGGGAAGCAAGG - Intergenic
995142190 5:108747795-108747817 AAAAGTCTACTACAGGAACATGG + Intergenic
997187890 5:131900597-131900619 TAAAATCTCCTAGAGGAGGAAGG - Intronic
1000059685 5:157642916-157642938 TAAGGTCTTCTTTAGGAGAAAGG - Intronic
1004806834 6:19211600-19211622 CAAAGTCTCCTGGAGGAACATGG + Intergenic
1007973996 6:46081914-46081936 AAAAGGCTCCTTTGGGAGCAGGG - Intergenic
1008020791 6:46575296-46575318 TAAAGTCACCTAAAGGAGTATGG - Intronic
1008995668 6:57655765-57655787 TAAAGTCACCTTCAGGAGTATGG + Intergenic
1009184197 6:60554534-60554556 TAAAGTCACCTTCAGGAGTATGG + Intergenic
1009621695 6:66085522-66085544 TAAGGTCTCCTAGAGGAGCAAGG + Intergenic
1012833280 6:104232403-104232425 TAAAGTATCCAATATGGGCAGGG + Intergenic
1014758105 6:125324321-125324343 TAAATGCTCCTAAAGTAGCATGG - Intergenic
1015126566 6:129761749-129761771 TAAAGTCTCCCAAATGATCAAGG - Intergenic
1015303749 6:131683267-131683289 TAAAGTCTCTTGAAGAAGCAAGG + Intronic
1016075399 6:139789182-139789204 TAAAGTCTCCTAGAAGAGCATGG + Intergenic
1016237506 6:141886577-141886599 TAAAGTCTCCCAGGGGAGCATGG - Intergenic
1026680829 7:72465388-72465410 TAGAGCCTACTATAGGGGCAAGG - Intergenic
1027630448 7:80597808-80597830 AAAAGTCTCCAACAGCAGCATGG - Intronic
1028177512 7:87674880-87674902 TAAAGGCTCCCACAGGAGCATGG + Intronic
1029939049 7:104460155-104460177 TAATGTCTTCTATGGGAACATGG - Intronic
1030401701 7:109059452-109059474 TAAAGTCTCCTAGGGGAGCAAGG + Intergenic
1030859511 7:114607193-114607215 TAAAGTCTCCTCTAGTCACATGG - Intronic
1032999921 7:137492721-137492743 TAAAGTTTCCTAGGGGAGCATGG - Intronic
1036235986 8:7039955-7039977 AGCAGTCTCCTATAGGAGCTGGG + Intergenic
1037577097 8:20217263-20217285 TGAAGTCTGCTATTGGAGAAGGG + Exonic
1040962706 8:53051852-53051874 TAAAGTCTCTTAGGAGAGCATGG + Intergenic
1042684421 8:71422291-71422313 TAATGTCTCCAAAAGGAGGAAGG - Intronic
1043131942 8:76472973-76472995 AAAAATCTCCTAGGGGAGCATGG + Intergenic
1043641254 8:82452671-82452693 CAAAGTCTCCTAGAGGAGCATGG + Intergenic
1043979547 8:86622260-86622282 TAAAGTCTGTTATATGAACAAGG - Intronic
1044224141 8:89700852-89700874 CAAAGTCACCTAGAGGAGCATGG + Intergenic
1046597073 8:116273247-116273269 TTAAATCTCCTAGAGGAGCATGG + Intergenic
1046790614 8:118318004-118318026 TGACCACTCCTATAGGAGCAAGG - Intronic
1047077118 8:121416285-121416307 TAACTTCTCCTAAAGCAGCAAGG + Intergenic
1050684094 9:8147595-8147617 TAAAGCTTCCTACAGGATCATGG - Intergenic
1051096999 9:13477555-13477577 TAAAGTCTCCTAGAGCAGCATGG + Intergenic
1055337922 9:75251777-75251799 AAGAGCCTCCTATAGGAGTATGG + Intergenic
1058724943 9:107793607-107793629 TAGAGTCTCCTATTGGCTCATGG + Intergenic
1059510352 9:114839493-114839515 TAAAGCCACCTAGAGGAGTATGG - Intergenic
1060144392 9:121238923-121238945 TGAAGTCTGCTATTGGAGAAGGG - Intronic
1187607863 X:20905907-20905929 TGAAGTCTCCTAGAGGAGCATGG + Intergenic
1187801383 X:23067515-23067537 TAAAGTCACCTAGAGGAGTATGG - Intergenic
1188147388 X:26630455-26630477 TAAAGTCACCTATAGGAGTATGG + Intergenic
1188147897 X:26636781-26636803 TAAAGTCTCTAATAGGCTCATGG + Intergenic
1188322421 X:28756172-28756194 GAAAGTCTCCTGGAGAAGCAAGG - Intronic
1188682217 X:33025100-33025122 TAAAGCGTATTATAGGAGCATGG + Intronic
1188757089 X:33975344-33975366 CAAAGCCACCTAGAGGAGCAAGG + Intergenic
1189891841 X:45610839-45610861 CAAATTCTCCTAAAGGAGCATGG + Intergenic
1190020885 X:46873806-46873828 TGAAGACTCCTATAGCAGCCAGG - Intronic
1190973751 X:55379298-55379320 CAAAGCCCCCTAGAGGAGCATGG - Intergenic
1191816701 X:65253532-65253554 TAAAGTGTCCTAGGGGAGCATGG - Intergenic
1192983344 X:76370290-76370312 TAAAGTCTCCTAAAAAAGCAAGG + Intergenic
1193036657 X:76958293-76958315 TAAAGTCTCCTAGGGGAGCATGG + Intergenic
1193276191 X:79590567-79590589 TAAAGTTTCTTAGGGGAGCAAGG + Intergenic
1193514998 X:82452095-82452117 TAGAGTCTCCCAGGGGAGCAAGG - Intergenic
1193575795 X:83194062-83194084 TAAAGCCACCTAGAGAAGCATGG + Intergenic
1193578373 X:83231685-83231707 CAAAGTCTCTTAGGGGAGCATGG + Intergenic
1193799146 X:85914252-85914274 TAAAACCACCTAGAGGAGCATGG - Intronic
1194519622 X:94902206-94902228 TAAAGTTTCCTACGGGAGCAAGG + Intergenic
1194571257 X:95556934-95556956 TAAATTCTTCTATAGTAGAATGG - Intergenic
1194848292 X:98839135-98839157 CAAAGCCACCTAAAGGAGCATGG + Intergenic
1195144463 X:101999623-101999645 TAAAGTCTCCTAGAGGGGCATGG - Intergenic
1195303777 X:103558315-103558337 TACAGTCTCCTCCAGGAGTAGGG + Intergenic
1196462944 X:115948304-115948326 TAAGGTTTCTTATAGGAGAAAGG + Intergenic
1196574499 X:117302382-117302404 TAAAGTCTTCTAAAGGAATATGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197093859 X:122571522-122571544 TTTAGTCTCCTAAGGGAGCATGG - Intergenic
1197370677 X:125622037-125622059 TAAAGTCTGCTAAGGGAGAAAGG + Intergenic
1197551474 X:127897837-127897859 TAAAGTCTTCTAGGGGAGCATGG - Intergenic
1197582319 X:128298964-128298986 TAAATTCTCCTAAAGATGCATGG - Intergenic
1198579598 X:138049018-138049040 CAAAGCCACCTACAGGAGCATGG - Intergenic
1199640691 X:149858356-149858378 TAAAGTCTTCTAGAGGAAAATGG - Intergenic
1200013632 X:153140807-153140829 TCAAGTGTCCTGAAGGAGCAAGG + Intergenic
1200025969 X:153259111-153259133 TCAAGTGTCCTGAAGGAGCAAGG - Intergenic