ID: 990174050

View in Genome Browser
Species Human (GRCh38)
Location 5:53087380-53087402
Sequence TTGTGTAAGCAGGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990174050_990174055 -5 Left 990174050 5:53087380-53087402 CCTTTCTCCTCCTGCTTACACAA 0: 1
1: 0
2: 1
3: 34
4: 377
Right 990174055 5:53087398-53087420 CACAAAATGGTCTGGAGCTTAGG 0: 1
1: 0
2: 2
3: 29
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990174050 Original CRISPR TTGTGTAAGCAGGAGGAGAA AGG (reversed) Intronic
900987932 1:6083786-6083808 TAGTGTCAGCAGGAGAAGCAAGG - Intronic
902082958 1:13833740-13833762 TTGTGTGAACAGGAAGAGAGGGG + Intergenic
903904191 1:26672142-26672164 TTGTGTGAGGAGGAGGGGAGTGG - Intergenic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
905641858 1:39595488-39595510 TTGGGTGTTCAGGAGGAGAAGGG - Intergenic
906406696 1:45548003-45548025 TTGTCTAGGCTGGAGTAGAATGG + Intergenic
908245735 1:62226496-62226518 TTAGGTAACCTGGAGGAGAAGGG - Intergenic
909039801 1:70635641-70635663 TTGAGTAAGCTGGAGAAGAATGG + Intergenic
909222091 1:72978344-72978366 CAGTGTAAGCAAGAGTAGAAGGG + Intergenic
910909281 1:92216626-92216648 TTGGGTAAGCAAGAAGAGATGGG + Intergenic
911204706 1:95080548-95080570 GTTTGAAAGAAGGAGGAGAATGG + Intergenic
911290099 1:96046949-96046971 TTCCCTAAGCAGGAGGAGCATGG + Intergenic
911580239 1:99625609-99625631 TTGTGTGAGTAGGAGGGGAAAGG + Intergenic
912129878 1:106587752-106587774 TGGTGTAGGCTGGAGGAGAGAGG + Intergenic
912265212 1:108150516-108150538 TATTGGAAGCTGGAGGAGAATGG - Intronic
912939748 1:114034417-114034439 TTCTGAAAGCAAGAGGAGTAAGG - Intergenic
913497477 1:119441752-119441774 TTGGGCAAGTAGGAGGAGAGTGG - Intergenic
914711417 1:150217057-150217079 TTCTGTAACCAAGAGGTGAAAGG + Intergenic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
915074213 1:153295544-153295566 TTATGTAAGCAGGGGAAGAGTGG - Intergenic
916444887 1:164863142-164863164 TTGTGTCTGAAGGAAGAGAAGGG - Intronic
916555783 1:165893055-165893077 TTGTGGTGGCAGGAGGAGAGAGG + Intronic
917606151 1:176631951-176631973 GAGTGTAAGCAAAAGGAGAAAGG + Intronic
918288506 1:183082536-183082558 GTGTGTACGCAGGAGTTGAAGGG + Intronic
918326875 1:183418323-183418345 TTGTGTCTGCAGAGGGAGAAAGG + Exonic
918994450 1:191738876-191738898 TTATGTGATCAGGAGGAGAGGGG + Intergenic
919412982 1:197269634-197269656 TTGTGCAGGTAGGAGAAGAAAGG + Intronic
920163109 1:204015100-204015122 TTGAGTAGGTAGGAGTAGAAGGG + Intergenic
921003527 1:211069015-211069037 TTCTGGCAGCAGGAGGAGAAAGG + Intronic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
921695473 1:218204205-218204227 TGGAGTTGGCAGGAGGAGAAGGG - Intergenic
922956977 1:229611298-229611320 TCTTGTAAACAGGAGGAGAATGG - Intronic
923490899 1:234483232-234483254 GGGTGTTAGCAGCAGGAGAAAGG - Intergenic
923595125 1:235355327-235355349 TTGTGTAAGAAAGAAAAGAAGGG + Intergenic
1062969039 10:1631714-1631736 ATCTGGCAGCAGGAGGAGAATGG - Intronic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1064908153 10:20370245-20370267 TTGTGTACCTAGGAGGATAATGG + Intergenic
1067129676 10:43551559-43551581 TTGTGTATGCAGGATATGAAGGG + Intergenic
1067701515 10:48576330-48576352 TTGGATGACCAGGAGGAGAATGG - Intronic
1068819321 10:61355108-61355130 TTCTGAAATCAGGAGGAAAAAGG + Intergenic
1069428941 10:68315736-68315758 TTGTGCAAGCAGAAAGTGAAAGG + Intronic
1069854082 10:71429861-71429883 TTCTGGCAGCAGGAGGACAAGGG + Intronic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071885423 10:89944523-89944545 TTGTGTAGGTTTGAGGAGAAGGG - Intergenic
1072508889 10:96098108-96098130 TTGGGTAAGCAGGAGGGTACAGG - Intergenic
1072563547 10:96598773-96598795 TTTTCTAAGCAAGAGTAGAAGGG + Intronic
1073201672 10:101740530-101740552 TTGGGAAAGTGGGAGGAGAAGGG + Intergenic
1075229199 10:120658369-120658391 TTGAGTAGCCAGGAGGAGCAGGG + Intergenic
1076601405 10:131659077-131659099 TTATGTAAGGTGGAGGAGCAGGG + Intergenic
1077230168 11:1455154-1455176 TTGGGTTAGGAGGAGCAGAAAGG + Intronic
1077308081 11:1876729-1876751 TTGTGGAGGAAGGAGAAGAAGGG + Intronic
1079056296 11:17208867-17208889 TCTTTTAAGCAGTAGGAGAAGGG + Intronic
1079797583 11:24825416-24825438 TGGGGAAAGCAGGAGGAGAGAGG - Intronic
1082631085 11:55543072-55543094 TTGTGTAAGCAATAAGAGCATGG - Intergenic
1083513972 11:63238684-63238706 TTGTGTATGTAGGAGGAAATTGG + Intronic
1083901131 11:65644104-65644126 TGGTTTAAGGAGGAGGAGCAGGG + Intronic
1084383012 11:68825610-68825632 TGGTGTAAAAAGGATGAGAAAGG + Intronic
1085024046 11:73226313-73226335 TTTTCTAAGGAGGAGGAGACAGG + Intronic
1085805222 11:79629717-79629739 TTGTGATCTCAGGAGGAGAAGGG + Intergenic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1085979327 11:81704156-81704178 CTGTGTAACCAAGAAGAGAATGG - Intergenic
1087032167 11:93716501-93716523 TTGTGTAATCAGGAGGACCAGGG + Intronic
1087800529 11:102498498-102498520 TTTTGAAAGGAAGAGGAGAATGG + Exonic
1087850493 11:103022769-103022791 TTGAGTAAGCAAGAGAAGATGGG + Intergenic
1088458812 11:110061080-110061102 TTGAGTAAGCAAGAGGGGAATGG + Intergenic
1088644095 11:111902552-111902574 TTGGATAAGGAGGATGAGAAAGG - Intergenic
1089737092 11:120557009-120557031 TTCTGTGGGCAGGAGGAGACTGG - Intronic
1090819306 11:130326669-130326691 CTGAGTAAGCGAGAGGAGAAGGG - Intergenic
1090961238 11:131558755-131558777 TAGTGTCAGCTGGAGGAGAAGGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091527026 12:1313136-1313158 TTTTGCAAGCAGGAGGAAGAAGG - Intronic
1091985226 12:4905437-4905459 TTGAGAAAGCAAAAGGAGAATGG - Intergenic
1092047771 12:5444477-5444499 TGGTGAAAGTAGGAGGAGATGGG + Intronic
1092548498 12:9472297-9472319 TTCTCTAAGCAGGAAGAGAGGGG - Intergenic
1092549355 12:9481219-9481241 TTCTGTACCCAGGAGGAGAGAGG - Intergenic
1093847746 12:23994671-23994693 GTGTGTGGGCAGGAGGAGAGAGG + Intergenic
1093899035 12:24608484-24608506 TTGTGAAAGCAAAAGAAGAAGGG - Intergenic
1094228049 12:28068577-28068599 TTCTGAAAGCAGAAAGAGAAAGG + Intergenic
1094362095 12:29641013-29641035 TTGTGTATGTAGGAGGATTACGG - Intronic
1094521910 12:31199925-31199947 TTCTGTACCCAGGAGGAGAGAGG + Intergenic
1095536753 12:43257938-43257960 ATGTCTTTGCAGGAGGAGAATGG + Intergenic
1097523938 12:60706598-60706620 TTGTGTAAGCAGTGAGATAAAGG + Intergenic
1098719300 12:73875317-73875339 TGGTGAAAGCAGGAGCAGGAGGG - Intergenic
1100097559 12:91060668-91060690 TTGTGTAAGTAGGAACATAATGG + Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1100347396 12:93745900-93745922 TTTTGTAATAAGGTGGAGAAGGG - Intronic
1100495069 12:95117148-95117170 TTGTTTTGGCAGGAGCAGAAAGG - Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1104046883 12:125169620-125169642 TTTTGTGACCATGAGGAGAAGGG - Intergenic
1104182899 12:126399502-126399524 GTGTTTAAGGAAGAGGAGAAAGG - Intergenic
1104598092 12:130133541-130133563 ATCTGTAAGCATGAGGAGAATGG - Intergenic
1104655409 12:130570872-130570894 TTCTTTAAGCAGGTGGATAAAGG + Intronic
1106013508 13:25846843-25846865 TTGTGCAACCAGGTGGAGAAGGG - Intronic
1106916748 13:34524071-34524093 TTGAGGAAGCAGAAGCAGAATGG + Intergenic
1107733909 13:43375878-43375900 CTGTGTTAGGAAGAGGAGAAAGG - Intronic
1108731945 13:53244551-53244573 TGGGGCAAGGAGGAGGAGAACGG - Intergenic
1108977389 13:56464410-56464432 TTGTGTATGCAGCAGGAGTGGGG - Intergenic
1110073028 13:71202978-71203000 TAGTGTAAGGTGGAGTAGAATGG + Intergenic
1110330524 13:74267068-74267090 TTATGCAAGTATGAGGAGAATGG - Intergenic
1110335056 13:74319024-74319046 TTGTGTAAGACTAAGGAGAATGG - Intergenic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1111166171 13:84460518-84460540 ATGTGTTACAAGGAGGAGAAGGG - Intergenic
1112917320 13:104567405-104567427 ATGTGTACGAAGGAGGAGAAAGG + Intergenic
1113254746 13:108495313-108495335 TCCTGGGAGCAGGAGGAGAAGGG - Intergenic
1113524517 13:110964341-110964363 TTGCTTACGAAGGAGGAGAAAGG - Intergenic
1113701535 13:112392432-112392454 TTGCTTATGAAGGAGGAGAAAGG + Intronic
1114181650 14:20373139-20373161 ATGTGTCATCTGGAGGAGAAAGG + Exonic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115140679 14:30167979-30168001 TGGTGAAAGCAGGAGGAAGAAGG + Intronic
1115517700 14:34202515-34202537 TTCTGTAAGAAGGAGGAGTGTGG - Intronic
1115874608 14:37846354-37846376 TTGTTTTAGCATGAGCAGAAGGG - Intronic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1118162312 14:63302348-63302370 TTGTGTACCCAGGAGGATTATGG - Intergenic
1118948524 14:70411929-70411951 TTGTGTAAGCAAGAGAAAATAGG + Intronic
1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG + Intergenic
1118964889 14:70571589-70571611 TTGTATAGGCATGGGGAGAATGG - Intergenic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1125432212 15:39607022-39607044 TTGTGGGAGCATGAGGAGAGTGG - Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1127527993 15:59812996-59813018 TTGTTTAAGGAGGAGGAGACAGG - Intergenic
1130034691 15:80347368-80347390 TTGTGTAAACAAGAGGAAAAGGG + Intronic
1130450473 15:84046230-84046252 TTGCGTAAGCGAGAGGAGAGTGG - Intergenic
1130573705 15:85071789-85071811 GTGTGTAAACAGGATGAGAAGGG + Intronic
1130772101 15:86934930-86934952 GTGTGATATCAGGAGGAGAATGG - Intronic
1131687087 15:94779755-94779777 TTTTGGAAAGAGGAGGAGAAAGG + Intergenic
1131809220 15:96154993-96155015 GTGTATATGCAGGAGGGGAAGGG + Intergenic
1132088865 15:98931139-98931161 TTGAGAAGTCAGGAGGAGAATGG + Intronic
1132366950 15:101264723-101264745 GGGTGTCAGGAGGAGGAGAATGG + Intergenic
1132366957 15:101264753-101264775 GGGTGTCAGGAGGAGGAGAATGG + Intergenic
1132679295 16:1133173-1133195 TTTTGTAAGCAAGAGTGGAACGG - Intergenic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1137596928 16:49730267-49730289 TTCTCTGAGTAGGAGGAGAAGGG - Intronic
1137869357 16:51934490-51934512 TTGTGTAAGGAGGAAGACATTGG + Intergenic
1138719422 16:59061677-59061699 GTGTGTTAGCAGGAGATGAAGGG - Intergenic
1138879084 16:60988826-60988848 TTTATTAAGCAGGAGGAGAGGGG - Intergenic
1138957703 16:61991218-61991240 TTGGGTAAGCAGGGGCGGAAGGG + Intronic
1139061846 16:63262931-63262953 TTATGGAAGCAGCAGGGGAAGGG + Intergenic
1139290118 16:65850048-65850070 TTTTGTAAGTGGGAGAAGAAAGG - Intergenic
1140190623 16:72812758-72812780 TGGTGTAAGCAAGAGGGGCATGG - Intronic
1142814585 17:2415202-2415224 TTGTGCACATAGGAGGAGAAGGG - Intronic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1143724609 17:8836664-8836686 TTCTGTAGGAAGGTGGAGAATGG - Intronic
1143739307 17:8941077-8941099 GTGTGTCAGCAGCAGGACAATGG + Intronic
1143983472 17:10891252-10891274 TTGTGGAGGGAGGAGGAAAAGGG - Intergenic
1144401944 17:14913174-14913196 TCCTGCAAGCAGGAGGTGAAGGG + Intergenic
1144668921 17:17120519-17120541 TTGTTTAGGCAGGAGGACACAGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1145282957 17:21481020-21481042 TTCTGAAAGTAGGAGCAGAATGG - Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149052397 17:52322093-52322115 TTTTTTAGGCAAGAGGAGAAAGG + Intergenic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1149653292 17:58292491-58292513 TAGTGGCAGCAGCAGGAGAAGGG + Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151713103 17:75817893-75817915 TAGTGTCACCGGGAGGAGAAGGG + Intronic
1153387496 18:4514525-4514547 TGGGGTAAGCTGGGGGAGAAGGG - Intergenic
1153639122 18:7139588-7139610 TTGCGTAACTAGGAAGAGAAGGG + Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154094075 18:11393844-11393866 TTGTGTAACTAGGAGGATTATGG - Intergenic
1155050949 18:22147281-22147303 TTGTACAATGAGGAGGAGAAGGG + Intergenic
1155146333 18:23086717-23086739 TTGTGTAGGCAAGAGCAGGATGG - Intergenic
1155170727 18:23265220-23265242 ATGAGAGAGCAGGAGGAGAACGG + Intronic
1155436460 18:25817741-25817763 TCGTGTTAGCAGGTGGTGAAAGG - Intergenic
1155689969 18:28607906-28607928 CTGTGCGAGCAGGAAGAGAAAGG + Intergenic
1156022231 18:32612867-32612889 TTGTGTAAATAGGAGTAGACTGG + Intergenic
1156747534 18:40410629-40410651 TTGTTAGAGCAGAAGGAGAAAGG - Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156860077 18:41825968-41825990 TTGTGTAAGCAATATGAAAAAGG - Intergenic
1157494809 18:48149070-48149092 TTATTTAACCAGGAGGAGGAAGG + Intronic
1157972802 18:52289444-52289466 TTGTTTATGGAGGAGGAGATAGG - Intergenic
1158504035 18:58030262-58030284 TTGTGAAAGCTGGACAAGAAAGG + Intergenic
1159755567 18:72359785-72359807 TTTAGTAAGCAGTAGAAGAATGG - Intergenic
1160181025 18:76636325-76636347 TTCTGTAAACCAGAGGAGAAGGG + Intergenic
1160280330 18:77484346-77484368 TTCTGGTAGCAGCAGGAGAAAGG + Intergenic
1160517442 18:79486465-79486487 TGGTGTAGGCAGCGGGAGAAAGG - Exonic
1161149641 19:2701308-2701330 TTGACTAATCAGGAGGAAAACGG - Intronic
1161441581 19:4294701-4294723 TGGTCTAATCAGGAGGGGAAGGG + Intronic
1161865546 19:6829671-6829693 TTGGCCAAGGAGGAGGAGAAGGG + Intronic
1161876452 19:6914949-6914971 TGGTGAGAGCAGTAGGAGAAAGG + Intronic
1165889181 19:39100453-39100475 TTGTGGTAGCAAGAGGAGATGGG + Intronic
1166326839 19:42056294-42056316 TTTTTTAAACAGGAGGAGGAAGG + Intronic
925436544 2:3843106-3843128 CTGTGATAGCAGGGGGAGAAGGG + Intronic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925720966 2:6826626-6826648 TTGTGTCAGCAGGAAGATCAGGG + Intergenic
925941752 2:8827396-8827418 TGGTGACAGCAGGAGGAGCAGGG - Intronic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926858724 2:17285175-17285197 TTGTCTAAACAGTAAGAGAAGGG - Intergenic
927826233 2:26311908-26311930 TTGGGTAAGCTGAAGGCGAAGGG + Exonic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928116203 2:28546648-28546670 TTGGGGATGCAGGAGAAGAAAGG + Intronic
928691757 2:33806982-33807004 TTATGTAAGAAGGAAGCGAAAGG - Intergenic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929676319 2:43934777-43934799 TTGTGTAAACTGGTAGAGAAAGG - Exonic
929889996 2:45910936-45910958 TTGGGTGTGTAGGAGGAGAATGG + Intronic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
935175386 2:100644199-100644221 TTGTGTCTGCGGGAGGAGGAAGG + Intergenic
935588716 2:104825385-104825407 ATGTGGAAGCAGGTGGAGAGGGG + Intergenic
938038091 2:128053243-128053265 TTGTGTACCCAGGAGGATTATGG + Intergenic
939314358 2:140528696-140528718 TTTTGTAAGCAGTAGGAGCAAGG + Intronic
939665265 2:144943991-144944013 TTGTTTAAGCAGGAAAAGTAGGG + Intergenic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
940363980 2:152825629-152825651 TGGCGGAAGCAGGAGGAGAGAGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941146634 2:161854990-161855012 ATGTGGAAGATGGAGGAGAAAGG + Exonic
941217908 2:162737132-162737154 TTCTGTAAGCAGGTGGAAATGGG - Intronic
941420997 2:165282558-165282580 TTGTTTAAGTAGCAGGAAAAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942252629 2:174060510-174060532 GTGGGGAAGAAGGAGGAGAAAGG - Intergenic
943843123 2:192604636-192604658 TGGTGTGTGGAGGAGGAGAAGGG + Intergenic
944615415 2:201453998-201454020 ATATGTGAGCAGGATGAGAAAGG - Intronic
946109620 2:217403177-217403199 TTGTGAAGGTGGGAGGAGAAGGG + Intronic
946715862 2:222554706-222554728 TTGTGTGGGAAGGTGGAGAAGGG + Intronic
947785165 2:232811393-232811415 TTGTGAAAGAAAGAGAAGAAAGG + Intronic
1168960018 20:1862542-1862564 TTGTGTGAGAAGCAGGAGCAAGG + Intergenic
1169683108 20:8239083-8239105 AAGTGAAAGCAGGAGGAGATTGG + Intronic
1170135260 20:13066735-13066757 AAGTGTAAGAAGGAAGAGAAGGG - Intronic
1170489834 20:16861821-16861843 TTAAGTAAGCTGGATGAGAAAGG + Intergenic
1171055269 20:21900488-21900510 ATGTGTAAGCAGGAAGAGAGTGG + Intergenic
1172873211 20:38148435-38148457 TTGGCTGAGCAAGAGGAGAAAGG - Intronic
1173099687 20:40074070-40074092 TGGTGTAAGAAGGAGTGGAAAGG + Intergenic
1174216499 20:48920615-48920637 TGGTGTAGGAAGGAGGTGAAGGG - Intergenic
1174488410 20:50875335-50875357 TTGTGGAGGGAGGCGGAGAAGGG - Intronic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1176160650 20:63646166-63646188 GGGTGTAAGGAGGAGCAGAAAGG + Intronic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1177049412 21:16213433-16213455 TTGATTAAGCAAGAGGAAAAAGG + Intergenic
1177301326 21:19249278-19249300 TTGGGTACTCAGGAGGAAAAGGG - Intergenic
1177550597 21:22615821-22615843 TTGTTTAAGGAGGAGGACACAGG + Intergenic
1177648967 21:23936584-23936606 TTGTCTAAGAAGGAGGATCAGGG - Intergenic
1178068030 21:28928113-28928135 TAGGGAAAGAAGGAGGAGAATGG + Intergenic
1178174792 21:30084051-30084073 TTGTGTAAGCCAGAACAGAAAGG + Intergenic
1178787088 21:35663762-35663784 TTGTCTAGGCAAGAGGAGAGAGG - Intronic
1179769860 21:43606419-43606441 TGGTGTGAGCAGGAGGAAAGAGG + Intronic
1184906989 22:47494877-47494899 TTGTTTACGCAGGTTGAGAATGG + Intergenic
1184996510 22:48211028-48211050 CTGTGGGAGCAAGAGGAGAAGGG + Intergenic
1185270507 22:49927521-49927543 GTAGGTAATCAGGAGGAGAACGG + Exonic
949983957 3:9524015-9524037 CTGTGCAAGCAAGAAGAGAATGG - Intronic
950327117 3:12121226-12121248 ATGTGTAAGCAGAAAGAGACAGG - Intronic
950346687 3:12301727-12301749 GTGTGGTGGCAGGAGGAGAATGG - Intronic
951684153 3:25325748-25325770 TTGTGGAAGCAGGACCAGTAGGG + Intronic
951771903 3:26267630-26267652 TTGTGGAATCAGGAAGAGACAGG - Intergenic
952665043 3:35894345-35894367 TTGTGTAAACAAGAGGGGATGGG - Intergenic
952840728 3:37643148-37643170 TTGGCTCAGCAGGAGGGGAAAGG + Intronic
952973616 3:38674332-38674354 TTATGAAAACAGGAGGATAATGG - Intergenic
955115368 3:55993592-55993614 TTATTTAAGCATGAGGATAAAGG + Intronic
955321512 3:57977912-57977934 TTGTGTAAAAAGGTGGAGCAAGG - Intergenic
955551672 3:60091759-60091781 TGGTGGGAGCAGGAGAAGAAAGG - Intronic
959846141 3:111035969-111035991 TGGTGTACAAAGGAGGAGAAAGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
961801437 3:129453151-129453173 TTGAGTAGGCAAGAGGAGATGGG + Intronic
962119645 3:132548314-132548336 ATGTGTAAGCAGGCTGTGAAAGG + Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962733954 3:138307345-138307367 TAATATAAGCAGGAGGACAATGG - Intronic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
964290971 3:155179595-155179617 TGGCCTTAGCAGGAGGAGAAGGG + Intronic
964313013 3:155414377-155414399 TCGTGGGAGTAGGAGGAGAAAGG - Intronic
964441101 3:156711175-156711197 TTGTGGAAGATGGGGGAGAATGG + Intergenic
965115649 3:164484300-164484322 TTTCCAAAGCAGGAGGAGAAGGG + Intergenic
965616045 3:170593617-170593639 TTGTGGAAGGAGGGGGAGTAGGG - Intronic
965719103 3:171641683-171641705 ATGTGGAAGCAGGAGAGGAAGGG - Intronic
965843045 3:172929594-172929616 ATGAGAAGGCAGGAGGAGAAAGG - Intronic
966029235 3:175324297-175324319 TTGGGTAACCAGGCGTAGAAGGG - Exonic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966879463 3:184341853-184341875 ATGTGCAAACGGGAGGAGAAAGG - Intronic
969059926 4:4426349-4426371 TTCTGTAAGCAGGAGTGGGAGGG + Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
971901009 4:32658225-32658247 TTGTGTATGTAGGAGGATTATGG + Intergenic
974336979 4:60561072-60561094 TGATGTAAGCAGGAACAGAATGG - Intergenic
974474455 4:62361615-62361637 TTGTGTATCCAGGAGGATTATGG + Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975453568 4:74560029-74560051 TTTTGAAAGCAGCAAGAGAAAGG + Intergenic
977149554 4:93492932-93492954 TCGTAGAAGCAGGAGTAGAATGG - Intronic
978695817 4:111576842-111576864 TTGTGCAAGCAAGAAGGGAAGGG + Intergenic
978828857 4:113058135-113058157 TTTTGTAAGTAGGATGTGAAAGG - Intronic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
979483413 4:121244239-121244261 TTGTAAAAGAAGGGGGAGAATGG - Intergenic
979716999 4:123851867-123851889 TGGCGGCAGCAGGAGGAGAAGGG - Intergenic
980718337 4:136658290-136658312 TTTTTTAATGAGGAGGAGAAAGG - Intergenic
980726485 4:136768153-136768175 TTATGTTAGTAGAAGGAGAAAGG + Intergenic
981302404 4:143203174-143203196 GTGTGTAAGGATGAGGAGAGGGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982371473 4:154638351-154638373 TTCTGTAAACAGGGTGAGAATGG + Intronic
983028039 4:162761277-162761299 TTGTGTGGGCAGGAGGAACAAGG - Intergenic
983177387 4:164607115-164607137 TTGTCTGAGCAGGAAAAGAAGGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984043459 4:174767741-174767763 CTGTGCAAGCAGGAAGTGAAGGG - Intronic
984531477 4:180921826-180921848 TTGTGGCAGCAGGAGGGCAATGG + Intergenic
984701783 4:182822971-182822993 TTGTGGAAGTAGGAAGAGCAAGG + Intergenic
985190837 4:187370926-187370948 ATGTGTCAGCTGGAGGGGAATGG + Intergenic
985213733 4:187625876-187625898 TTTTCAAAGCAGGAAGAGAAAGG + Intergenic
986627796 5:9738846-9738868 ATGTGTATGCAGGAAGAGAGAGG - Intergenic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
989242788 5:39219679-39219701 TTGAGTAATAAGGAGGAGAAAGG + Intronic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
992701480 5:79345571-79345593 TTGAGTAAATAGGAGTAGAATGG + Intergenic
993347307 5:86800268-86800290 TTGTGAAAACAGAAGCAGAAAGG + Intergenic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995507989 5:112880350-112880372 GTGTGTAAGATGGAGGGGAAAGG + Intronic
996889686 5:128403449-128403471 TTGTGTACACAGGGTGAGAAAGG - Intronic
999482742 5:151964076-151964098 ATCTGGAAGCAGGAGCAGAATGG - Intergenic
999517932 5:152319759-152319781 TTTTGTAAGCAGCAGGAAAGAGG + Intergenic
999833519 5:155343176-155343198 TTGTGAAATCAGGAGGAGGGAGG - Intergenic
1001197872 5:169690013-169690035 TTATGGAAACAGGATGAGAAAGG - Intronic
1003325000 6:5084793-5084815 TGGGGAAAGCAGGAGCAGAAGGG + Exonic
1003825555 6:9947698-9947720 TTTTGAAAGCAAAAGGAGAAGGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004692524 6:18004650-18004672 TTGTGGAACCTGGTGGAGAAAGG + Intergenic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006672968 6:35741279-35741301 GTGTGTATGCAGGAGTGGAATGG + Intronic
1006812952 6:36832291-36832313 TTCTGTCAGCAGGAAGAGAGTGG - Intronic
1008646470 6:53519474-53519496 CTGTGCTAGCAGGAGGAGATGGG - Intronic
1008761230 6:54853136-54853158 ATGAGAAAGCTGGAGGAGAAAGG + Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1011634317 6:89356213-89356235 TTTTCTAAGCAGGAGGATTATGG - Intergenic
1012619679 6:101327056-101327078 TTGTTTCAGCATGAGGAGAATGG + Intergenic
1013425109 6:110004571-110004593 TGATGGAAGCAGGAGGAGAAAGG - Intergenic
1013577966 6:111503891-111503913 TTCTGTAGTCAGGAGGGGAAGGG + Intergenic
1013912054 6:115287688-115287710 CTGTGGTAGCAGTAGGAGAATGG - Intergenic
1014603888 6:123448507-123448529 TTGTGTAAGTAGGAGGATTATGG - Intronic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016942354 6:149493378-149493400 GGGTGTAAGCAGGATCAGAATGG - Intergenic
1017671496 6:156773621-156773643 TTGTGTCAGCGGGAGGATTAGGG + Intergenic
1018291285 6:162294260-162294282 GGGTGTAGGAAGGAGGAGAATGG - Intronic
1020276571 7:6628259-6628281 TTATGTGAGCAGGAGGAAAGAGG + Intergenic
1020414098 7:7925945-7925967 TGGTGAAAGCAGGAGCAGAGAGG - Intronic
1020959045 7:14779241-14779263 TTGTAAAAGCAGGTGGAGAGGGG + Intronic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022844759 7:34198920-34198942 TTTTGTAAGCAAGACTAGAAGGG - Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878735 7:44306922-44306944 GGGTGTGAGCAGGAAGAGAAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023896054 7:44433898-44433920 TTGTGGGAGCAGGAGGAAAAAGG - Intronic
1024625042 7:51200017-51200039 TTTTGAAAGCAGCAAGAGAAAGG + Intronic
1024771843 7:52732324-52732346 TTGTATTAGCAGCATGAGAATGG + Intergenic
1027350463 7:77306406-77306428 TTGTGTACCCAGGAGGATTATGG + Intronic
1027848919 7:83424059-83424081 TTATGTAAAAAGGAGAAGAAAGG + Intronic
1029239964 7:99153174-99153196 TTATGTAAGTGGGAGGAGAAAGG + Intergenic
1030715769 7:112805154-112805176 TTGGATAAGCAGGAGGAAAGGGG - Intergenic
1032281417 7:130505447-130505469 TATAGTAAGGAGGAGGAGAAGGG + Exonic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1034180493 7:149133789-149133811 TTGTGCAAGCTGGAGTACAATGG + Intronic
1034244826 7:149636279-149636301 TTGAGACAGAAGGAGGAGAATGG - Intergenic
1034310342 7:150082317-150082339 TGGTGTAAAAAGCAGGAGAAAGG - Intergenic
1034796503 7:154018336-154018358 TGGTGTAAAAAGCAGGAGAAAGG + Intronic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1036593489 8:10191050-10191072 TAGTCTAAGCAGCAGAAGAATGG - Intronic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037006044 8:13781334-13781356 TTTTGTAAGCAGGAACACAAAGG + Intergenic
1037364180 8:18104730-18104752 TGGTGAAAGCAGGAGCAAAAAGG - Intergenic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1038090123 8:24243039-24243061 ATGTGTATGCAAGAGGAGAGGGG + Intergenic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1040064960 8:43138296-43138318 TTGTGAACCGAGGAGGAGAAAGG - Intergenic
1040583564 8:48717269-48717291 TTTTGAAAGCAGCAAGAGAAAGG + Intronic
1041128595 8:54671239-54671261 TCGTGGAAGCAGCAAGAGAAAGG - Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1043769772 8:84183699-84183721 TTGGGAAAGCTGGAGGAGCATGG + Intronic
1045785435 8:105915839-105915861 CTGTGTAAGGAGGGTGAGAAGGG - Intergenic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050487617 9:6150592-6150614 TAATGTTGGCAGGAGGAGAAAGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051311922 9:15784488-15784510 TTCTGTAAAAAGGAGGAGAGGGG - Exonic
1051912134 9:22165154-22165176 TTGTTAAAGCAGGAGGAGGGAGG + Intergenic
1053038949 9:34852676-34852698 TTCTGAAAGCAGCAAGAGAAAGG - Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1057779786 9:98040235-98040257 TTGTCAAAGCAGGTGGAAAATGG - Intergenic
1058966364 9:110042626-110042648 GAGTGTAAGCAGGAGGACATGGG - Intronic
1059219899 9:112605474-112605496 TTGTGTAAGTAGGAAGGGCAGGG - Intronic
1059391483 9:114002188-114002210 TGATGAAAGTAGGAGGAGAATGG - Intronic
1059694712 9:116720117-116720139 TTGTGGGTGGAGGAGGAGAAGGG - Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060246781 9:121953139-121953161 TAGTTTAAGGAGGAGGAAAATGG + Intronic
1060713960 9:125903182-125903204 TTGTGTAAGCAGGTGAAAAGTGG + Intronic
1060755631 9:126211222-126211244 TTGTGGATGCAAGAGTAGAAGGG + Intergenic
1060879624 9:127108941-127108963 TTCTGGAAGCAAGAGGAGACAGG + Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1189101853 X:38198731-38198753 TTTTTTAAGCTGGATGAGAAAGG + Intronic
1189853401 X:45199339-45199361 TTGAGGAAGATGGAGGAGAAAGG + Intronic
1191696279 X:63994071-63994093 TTGAGGAAGCAGGAGGAAAAGGG + Intergenic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1196539669 X:116892671-116892693 TTTTGAAAGCAGGAAGAGAAAGG - Intergenic
1197057504 X:122138595-122138617 TAATGCAAGCAGGAGGAGCATGG + Intergenic
1200019382 X:153189049-153189071 TTGCGTGAGCAGTAGGAAAATGG + Intergenic
1202411958 Y:24583465-24583487 TTGTGCAAGGAGGAGGAGCCTGG - Intergenic